pET28a- ULP (SUMO)


  • Model: PVT10514
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10514

Packing 2ug


pET28a-ULP(SUMO) Information

Function Protease plasmids

Promoter: T7/lac

Replicon: pUC ori, F1 ori

Terminator: T7-ter

Plasmid classification: protease expression plasmid

Plasmid size: 5962bp

Plasmid tagging: N-His, ULP

Prokaryotic resistance: kanamycin Kanamycin

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: BL21 DE3

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues.

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG

Remarks: pET28a-ULP/SUMO plasmid expresses ULP enzyme and cleavage SUMO protein.


pET28a-ULP(SUMO) Sequence

LOCUS       Exported                5962 bp ds-DNA     circular SYN 11-SEP-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5962)
  TITLE     Direct Submission
  JOURNAL   Exported Sunday, September 11, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5962
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      12..467
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     CDS             complement(560..1375)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418 
                     (Geneticin(R)) in eukaryotes"
     rep_origin      1497..2085
                     /note="pUC ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     misc_feature    2271..2413
                     /note="basis of mobility region from pBR322"
     CDS             complement(2515..2706)
                     /product="Rop protein, which maintains plasmids at low copy
     CDS             complement(3515..4597)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4598..4675)
                     /note="lacI promoter"
     promoter        4984..5002
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    5003..5027
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             5083..5100
                     /product="6xHis affinity tag"
     CDS             5110..5127
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             5131..5139
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
     misc_feature    5140..5799
     CDS             5806..5823
                     /product="6xHis affinity tag"
     terminator      5890..5937
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA 
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
