pET302/ NT- His


  • Model: PVT0368
  • 49 Units in Stock
Ask a question

Add to Cart:

pET302/ NT-His

PVT0368       2ug                                                    pET302/NT-His Data sheet

pET302/NT-His informaiton

Promoter: T7/lac
Replicon: ColE1 ori, F1 ori
Terminator: T7 Terminator
Plasmid classification: Escherichia coli vector; PET series expression plasmid
Plasmid size: 5712bp
Plasmid Tags: N-6 * His
Prokaryotic resistance: ampicillin Amp
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expression host: BL21 (DE3)
Culture conditions: 37, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: T7:TAATACGACTCACTATAGGG
Primers for 3'sequencing: T7-ter:TGCTAGTTATTGCTCAGCGG


pET302/NT-His description

The Champion pET302/NT-His and pET303/CT-His Vector Kit is designed for cloning a gene of interest via restriction enzyme(s) and ligase (REaL) and subsequent high-level expression from the strong bacteriophage T7 promoter. In addition to the T7 promoter, each vector contains only the necessary functional elements and an N- or C-terminal 6xHis tag (pET302/NT-His and pET303/CT-His, respectively) for convenient purification and detection (Figure 1). Expression levels obtained from these vectors may be higher than those obtained from another suppliers pET vector (Figure 2). To maximize expression, use with MagicMedia E. coli Expression Medium.



pET302/NT-His Sequence

LOCUS       Exported                5712 bp ds-DNA     circular SYN 11-AUG-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5712)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-11 from SnapGene Viewer 2.8.0
FEATURES             Location/Qualifiers
     source          1..5712
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        20..38
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    39..63
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             112..129
                     /product="6xHis affinity tag"
     terminator      238..285
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     promoter        609..713
                     /note="AmpR promoter"
     CDS             714..1574
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1745..2333
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2519..2658
                     /note="basis of mobility region from pBR322"
     CDS             complement(2760..2951)
                     /product="Rop protein, which maintains plasmids at low copy
     CDS             complement(4263..5345)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(5346..5423)
                     /note="lacI promoter"
        1 gatctcgatc ccgcgaaatt aatacgactc actatagggg aattgtgagc ggataacaat
       61 tcccctctag aaataatttt gtttaaactt taagaaggag atatacatat gcatcatcat
      121 catcatcacg tgaattcgct cgagatcgat gatattcgag cctaggtata atcggatccg
      181 gctgctaaca aagcccgaaa ggaagctgag ttggctgctg ccaccgctga gcaataacta
      241 gcataacccc ttggggcctc taaacgggtc ttgaggggtt ttttgctgaa aggaggaact
      301 atatccggat atcccgcaag aggcccggca gtaccggcat aaccaagcct atgcctacag
      361 catccagggt gacggtgccg aggatgacga tgagcgcatt gttagatttc atacacggtg
      421 cctgactgcg ttagcaattt aactgtgata aactaccgca ttaaagctag cttatcgatg
      481 ataagctgtc aaacatgaga attaattctt gaagacgaaa gggcctcgtg atacgcctat
      541 ttttataggt taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg
      601 gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc
      661 tcatgagaca ataaccctga taaatgcttc aataatattg aaaaaggaag agtatgagta
      721 ttcaacattt ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg
      781 ctcacccaga aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg
      841 gttacatcga actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac
      901 gttttccaat gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtgttg
      961 acgccgggca agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt
     1021 actcaccagt cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg
     1081 ctgccataac catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac
     1141 cgaaggagct aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt
     1201 gggaaccgga gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgcag
     1261 caatggcaac aacgttgcgc aaactattaa ctggcgaact acttactcta gcttcccggc
     1321 aacaattaat agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc
     1381 ttccggctgg ctggtttatt gctgataaat ctggagccgg tgagcgtggg tctcgcggta
     1441 tcattgcagc actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg
     1501 ggagtcaggc aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga
     1561 ttaagcattg gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac
     1621 ttcattttta atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa
     1681 tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat
     1741 cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc
     1801 taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg
     1861 gcttcagcag agcgcagata ccaaatactg tccttctagt gtagccgtag ttaggccacc
     1921 acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg
     1981 ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg
     2041 ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa
     2101 cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg
     2161 aagggagaaa ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga
     2221 gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct
     2281 gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca
     2341 gcaacgcggc ctttttacgg ttcctggcct tttgctggcc ttttgctcac atgttctttc
     2401 ctgcgttatc ccctgattct gtggataacc gtattaccgc ctttgagtga gctgataccg
     2461 ctcgccgcag ccgaacgacc gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc
     2521 tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcaat ggtgcactct
     2581 cagtacaatc tgctctgatg ccgcatagtt aagccagtat acactccgct atcgctacgt
     2641 gactgggtca tggctgcgcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct
     2701 tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt
     2761 cagaggtttt caccgtcatc accgaaacgc gcgaggcagc tgcggtaaag ctcatcagcg
     2821 tggtcgtgaa gcgattcaca gatgtctgcc tgttcatccg cgtccagctc gttgagtttc
     2881 tccagaagcg ttaatgtctg gcttctgata aagcgggcca tgttaagggc ggttttttcc
     2941 tgtttggtca ctgatgcctc cgtgtaaggg ggatttctgt tcatgggggt aatgataccg
     3001 atgaaacgag agaggatgct cacgatacgg gttactgatg atgaacatgc ccggttactg
     3061 gaacgttgtg agggtaaaca actggcggta tggatgcggc gggaccagag aaaaatcact
     3121 cagggtcaat gccagcgctt cgttaataca gatgtaggtg ttccacaggg tagccagcag
     3181 catcctgcga tgcagatccg gaacataatg gtgcagggcg ctgacttccg cgtttccaga
     3241 ctttacgaaa cacggaaacc gaagaccatt catgttgttg ctcaggtcgc agacgttttg
     3301 cagcagcagt cgcttcacgt tcgctcgcgt atcggtgatt cattctgcta accagtaagg
     3361 caaccccgcc agcctagccg ggtcctcaac gacaggagca cgatcatgcg cacccgtggc
     3421 caggacccaa cgctgcccga gatgcgccgc gtgcggctgc tggagatggc ggacgcgatg
     3481 gatatgttct gccaagggtt ggtttgcgca ttcacagttc tccgcaagaa ttgattggct
     3541 ccaattcttg gagtggtgaa tccgttagcg aggtgccgcc ggcttccatt caggtcgagg
     3601 tggcccggct ccatgcaccg cgacgcaacg cggggaggca gacaaggtat agggcggcgc
     3661 ctacaatcca tgccaacccg ttccatgtgc tcgccgaggc ggcataaatc gccgtgacga
     3721 tcagcggtcc aatgatcgaa gttaggctgg taagagccgc gagcgatcct tgaagctgtc
     3781 cctgatggtc gtcatctacc tgcctggaca gcatggcctg caacgcgggc atcccgatgc
     3841 cgccggaagc gagaagaatc ataatgggga aggccatcca gcctcgcgtc gcgaacgcca
     3901 gcaagacgta gcccagcgcg tcggccgcca tgccggcgat aatggcctgc ttctcgccga
     3961 aacgtttggt ggcgggacca gtgacgaagg cttgagcgag ggcgtgcaag attccgaata
     4021 ccgcaagcga caggccgatc atcgtcgcgc tccagcgaaa gcggtcctcg ccgaaaatga
     4081 cccagagcgc tgccggcacc tgtcctacga gttgcatgat aaagaagaca gtcataagtg
     4141 cggcgacgat agtcatgccc cgcgcccacc ggaaggagct gactgggttg aaggctctca
     4201 agggcatcgg tcgagatccc ggtgcctaat gagtgagcta acttacatta attgcgttgc
     4261 gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc
     4321 aacgcgcggg gagaggcggt ttgcgtattg ggcgccaggg tggtttttct tttcaccagt
     4381 gagacgggca acagctgatt gcccttcacc gcctggccct gagagagttg cagcaagcgg
     4441 tccacgctgg tttgccccag caggcgaaaa tcctgtttga tggtggttaa cggcgggata
     4501 taacatgagc tgtcttcggt atcgtcgtat cccactaccg agatatccgc accaacgcgc
     4561 agcccggact cggtaatggc gcgcattgcg cccagcgcca tctgatcgtt ggcaaccagc
     4621 atcgcagtgg gaacgatgcc ctcattcagc atttgcatgg tttgttgaaa accggacatg
     4681 gcactccagt cgccttcccg ttccgctatc ggctgaattt gattgcgagt gagatattta
     4741 tgccagccag ccagacgcag acgcgccgag acagaactta atgggcccgc taacagcgcg
     4801 atttgctggt gacccaatgc gaccagatgc tccacgccca gtcgcgtacc gtcttcatgg
     4861 gagaaaataa tactgttgat gggtgtctgg tcagagacat caagaaataa cgccggaaca
     4921 ttagtgcagg cagcttccac agcaatggca tcctggtcat ccagcggata gttaatgatc
     4981 agcccactga cgcgttgcgc gagaagattg tgcaccgccg ctttacaggc ttcgacgccg
     5041 cttcgttcta ccatcgacac caccacgctg gcacccagtt gatcggcgcg agatttaatc
     5101 gccgcgacaa tttgcgacgg cgcgtgcagg gccagactgg aggtggcaac gccaatcagc
     5161 aacgactgtt tgcccgccag ttgttgtgcc acgcggttgg gaatgtaatt cagctccgcc
     5221 atcgccgctt ccactttttc ccgcgttttc gcagaaacgt ggctggcctg gttcaccacg
     5281 cgggaaacgg tctgataaga gacaccggca tactctgcga catcgtataa cgttactggt
     5341 ttcacattca ccaccctgaa ttgactctct tccgggcgct atcatgccat accgcgaaag
     5401 gttttgcgcc attcgatggt gtccgggatc tcgacgctct cccttatgcg actcctgcat
     5461 taggaagcag cccagtagta ggttgaggcc gttgagcacc gccgccgcaa ggaatggtgc
     5521 atgcaaggag atggcgccca acagtccccc ggccacgggg cctgccacca tacccacgcc
     5581 gaaacaagcg ctcatgagcc cgaagtggcg agcccgatct tccccatcgg tgatgtcggc
     5641 gatataggcg ccagcaaccg cacctgtggc gccggtgatg ccggccacga tgcgtccggc
     5701 gtagaggatc ga


Product is for research use only!

Search name

pET302/NT-His,Plasmid pET302/NT-His,pET302/NT-His vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
