pET303/ CT- His


  • Model: PVT0369
  • 50 Units in Stock
Ask a question

Add to Cart:

pET303/ CT-His

PVT0369       2ug

pET303/ CT-His Information

Promoter: T7/lac promoter

Replicator: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 5369bp

Plasmid label: C-6 x His

Prokaryotic resistance: ampicillin Amp

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli BL21 (DE3)

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG


pET303/ CT-His Description

PET303/CT-His pET303-CT-His is an Escherichia coli pET expression plasmid.The Champion pET302/NT-His and pET303/CT-His Vector Kit is designed for cloning a gene of interest via restriction enzyme(s) and ligase (REaL) and subsequent high-level expression from the strong bacteriophage T7 promoter. In addition to the T7 promoter, each vector contains only the necessary functional elements and an N- or C-terminal 6xHis tag (pET302/NT-His and pET303/CT-His, respectively) for convenient purification and detection (Figure 1). Expression levels obtained from these vectors may be higher than those obtained from another suppliers pET vector (Figure 2). To maximize expression, use with MagicMedia E. coli Expression Medium.



pET303/ CT-His Sequence

LOCUS       Exported                5369 bp ds-DNA     circular SYN 23-7-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5369)
  AUTHORS   Trial User
  TITLE     Direct Submission
  JOURNAL   Exported 2015-7-23
FEATURES             Location/Qualifiers
     source          1..5369
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        20..38
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    39..63
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     RBS             79..99
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     CDS             119..136
                     /product="6xHis affinity tag"
     terminator      203..250
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     rep_origin      287..742
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        769..873
                     /note="AmpR promoter"
     CDS             874..1734
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1905..2493
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     misc_feature    2679..2818
                     /note="basis of mobility region from pBR322"
     CDS             complement(2920..3111)
                     /product="Rop protein, which maintains plasmids at low copy
     CDS             complement(3920..5002)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(5003..5080)
                     /note="lacI promoter"
        1 gatctcgatc ccgcgaaatt aatacgactc actatagggg aattgtgagc ggataacaat
       61 tcccctctag taataatttt gtttaacttt aagaaggagg tctagaatgc atctcgagca
      121 ccaccaccac caccactgag atccggctgc taacaaagcc cgaaaggaag ctgagttggc
      181 tgctgccacc gctgagcaat aactagcata accccttggg gcctctaaac gggtcttgag
      241 gggttttttg ctgaaaggag gaactatatc cggattggcg aatgggacgc gccctgtagc
      301 ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc
      361 gccctagcgc ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt
      421 ccccgtcaag ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac
      481 ctcgacccca aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag
      541 acggtttttc gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa
      601 actggaacaa cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg
      661 atttcggcct attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattttaac
      721 aaaatattaa cgtttacaat ttcaggtggc acttttcggg gaaatgtgcg cggaacccct
      781 atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga
      841 taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc
      901 cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg
      961 aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc
     1021 aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact
     1081 tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc
     1141 ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag
     1201 catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat
     1261 aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt
     1321 ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa
     1381 gccataccaa acgacgagcg tgacaccacg atgcctgcag caatggcaac aacgttgcgc
     1441 aaactattaa ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg
     1501 gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt
     1561 gctgataaat ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca
     1621 gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat
     1681 gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca
     1741 gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg
     1801 atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg
     1861 ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt
     1921 ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg
     1981 ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata
     2041 ccaaatactg tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca
     2101 ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag
     2161 tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc
     2221 tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga
     2281 tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg
     2341 tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac
     2401 gcctggtatc tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg
     2461 tgatgctcgt caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg
     2521 ttcctggcct tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct
     2581 gtggataacc gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc
     2641 gagcgcagcg agtcagtgag cgaggaagcg gaagagcgcc tgatgcggta ttttctcctt
     2701 acgcatctgt gcggtatttc acaccgcaat ggtgcactct cagtacaatc tgctctgatg
     2761 ccgcatagtt aagccagtat acactccgct atcgctacgt gactgggtca tggctgcgcc
     2821 ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc
     2881 ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt caccgtcatc
     2941 accgaaacgc gcgaggcagc tgcggtaaag ctcatcagcg tggtcgtgaa gcgattcaca
     3001 gatgtctgcc tgttcatccg cgtccagctc gttgagtttc tccagaagcg ttaatgtctg
     3061 gcttctgata aagcgggcca tgttaagggc ggttttttcc tgtttggtca ctgatgcctc
     3121 cgtgtaaggg ggatttctgt tcatgggggt aatgataccg atgaaacgag agaggatgct
     3181 cacgatacgg gttactgatg atgaacatgc ccggttactg gaacgttgtg agggtaaaca
     3241 actggcggta tggatgcggc gggaccagag aaaaatcact cagggtcaat gccagcgctt
     3301 cgttaataca gatgtaggtg ttccacaggg tagccagcag catcctgcga tgcagatccg
     3361 gaacataatg gtgcagggcg ctgacttccg cgtttccaga ctttacgaaa cacggaaacc
     3421 gaagaccatt catgttgttg ctcaggtcgc agacgttttg cagcagcagt cgcttcacgt
     3481 tcgctcgcgt atcggtgatt cattctgcta accagtaagg caaccccgcc agcctagccg
     3541 ggtcctcaac gacaggagca cgatcatgcg cacccgtggg gccgccatgc cggcgataat
     3601 ggcctgcttc tcgccgaaac gtttggtggc gggaccagtg acgaaggctt gagcgagggc
     3661 gtgcaagatt ccgaataccg caagcgacag gccgatcatc gtcgcgctcc agcgaaagcg
     3721 gtcctcgccg aaaatgaccc agagcgctgc cggcacctgt cctacgagtt gcatgataaa
     3781 gaagacagtc ataagtgcgg cgacgatagt catgccccgc gcccaccgga aggagctgac
     3841 tgggttgaag gctctcaagg gcatcggtcg agatcccggt gcctaatgag tgagctaact
     3901 tacattaatt gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct
     3961 gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc gccagggtgg
     4021 tttttctttt caccagtgag acgggcaaca gctgattgcc cttcaccgcc tggccctgag
     4081 agagttgcag caagcggtcc acgctggttt gccccagcag gcgaaaatcc tgtttgatgg
     4141 tggttaacgg cgggatataa catgagctgt cttcggtatc gtcgtatccc actaccgaga
     4201 tatccgcacc aacgcgcagc ccggactcgg taatggcgcg cattgcgccc agcgccatct
     4261 gatcgttggc aaccagcatc gcagtgggaa cgatgccctc attcagcatt tgcatggttt
     4321 gttgaaaacc ggacatggca ctccagtcgc cttcccgttc cgctatcggc tgaatttgat
     4381 tgcgagtgag atatttatgc cagccagcca gacgcagacg cgccgagaca gaacttaatg
     4441 ggcccgctaa cagcgcgatt tgctggtgac ccaatgcgac cagatgctcc acgcccagtc
     4501 gcgtaccgtc ttcatgggag aaaataatac tgttgatggg tgtctggtca gagacatcaa
     4561 gaaataacgc cggaacatta gtgcaggcag cttccacagc aatggcatcc tggtcatcca
     4621 gcggatagtt aatgatcagc ccactgacgc gttgcgcgag aagattgtgc accgccgctt
     4681 tacaggcttc gacgccgctt cgttctacca tcgacaccac cacgctggca cccagttgat
     4741 cggcgcgaga tttaatcgcc gcgacaattt gcgacggcgc gtgcagggcc agactggagg
     4801 tggcaacgcc aatcagcaac gactgtttgc ccgccagttg ttgtgccacg cggttgggaa
     4861 tgtaattcag ctccgccatc gccgcttcca ctttttcccg cgttttcgca gaaacgtggc
     4921 tggcctggtt caccacgcgg gaaacggtct gataagagac accggcatac tctgcgacat
     4981 cgtataacgt tactggtttc acattcacca ccctgaattg actctcttcc gggcgctatc
     5041 atgccatacc gcgaaaggtt ttgcgccatt cgatggtgtc cgggatctcg acgctctccc
     5101 ttatgcgact cctgcattag gaagcagccc agtagtaggt tgaggccgtt gagcaccgcc
     5161 gccgcaagga atggtgcatg caaggagatg gcgcccaaca gtcccccggc cacggggcct
     5221 gccaccatac ccacgccgaa acaagcgctc atgagcccga agtggcgagc ccgatcttcc
     5281 ccatcggtga tgtcggcgat ataggcgcca gcaaccgcac ctgtggcgcc ggtgatgccg
     5341 gccacgatgc gtccggcgta gaggatcga


Search name

pET303/CT-His,Plasmid pET303/CT-His,pET303/CT-His vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
