pET-4CDS

$280.00

  • Model: PVT40104
  • 20 Units in Stock
Ask a question


Add to Cart:

pET-4CDS
 

PVT40104     2ug

 

pET-4CDS Description

Plasmid type: E. coli protein expression vector has four polyclonal sites

Copy number: high

Cloning methods: polyclonal sites, restriction endonuclease

Size: 5912bp

Mcs1 5 'sequencing primer and sequence: pet upstream, gatccgcgaaattaatacg

Mcs2 5 'sequencing primer and sequence: m13f, gtaaaaacgacggccagt

Mcs3 5 'sequencing primer and sequence: m13r, caggaaacagctatgac

Mcs4 5 'sequencing primer and sequence: pCMV-F, tctaaaagctgcggaattgt

Tag: n-flag, n-stream-tag II, n-s-tag, c-6xhis

Resistance: Kan

Host bacteria: BL21 (DE3), rosetta2 (DE3), C43 (DE3)

Note: pet-4cds is designed to express four target genes at the same time.

Stability: transient expression

Constituent: constituent

Virus / non virus: non virus

 

pET-4CDS Sequence

1        GCCCCAGCAG GCGAAAATCC TGTTTGATGG TGGTTAACGG CGGGATATAA CATGAGCTGT
61       CTTCGGTATC GTCGTATCCC ACTACCGAGA TATCCGCACC AACGCGCAGC CCGGACTCGG
121      TAATGGCGCG CATTGCGCCC AGCGCCATCT GATCGTTGGC AACCAGCATC GCAGTGGGAA
181      CGATGCCCTC ATTCAGCATT TGCATGGTTT GTTGAAAACC GGACATGGCA CTCCAGTCGC
241      CTTCCCGTTC CGCTATCGGC TGAATTTGAT TGCGAGTGAG ATATTTATGC CAGCCAGCCA
301      GACGCAGACG CGCCGAGACA GAACTTAATG GGCCCGCTAA CAGCGCGATT TGCTGGTGAC
361      CCAATGCGAC CAGATGCTCC ACGCCCAGTC GCGTACCGTC TTCATGGGAG AAAATAATAC
421      TGTTGATGGG TGTCTGGTCA GAGACATCAA GAAATAACGC CGGAACATTA GTGCAGGCAG
481      CTTCCACAGC AATGGCATCC TGGTCATCCA GCGGATAGTT AATGATCAGC CCACTGACGC
541      GTTGCGCGAG AAGATTGTGC ACCGCCGCTT TACAGGCTTC GACGCCGCTT CGTTCTACCA
601      TCGACACCAC CACGCTGGCA CCCAGTTGAT CGGCGCGAGA TTTAATCGCC GCGACAATTT
661      GCGACGGCGC GTGCAGGGCC AGACTGGAGG TGGCAACGCC AATCAGCAAC GACTGTTTGC
721      CCGCCAGTTG TTGTGCCACG CGGTTGGGAA TGTAATTCAG CTCCGCCATC GCCGCTTCCA
781      CTTTTTCCCG CGTTTTCGCA GAAACGTGGC TGGCCTGGTT CACCACGCGG GAAACGGTCT
841      GATAAGAGAC ACCGGCATAC TCTGCGACAT CGTATAACGT TACTGGTTTC ACATTCACCA
901      CCCTGAATTG ACTCTCTTCC GGGCGCTATC ATGCCATACC GCGAAAGGTT TTGCGCCATT
961      CGATGGTGTC CGGGATCTCG ACGCTCTCCC TTATGCGACT CCTGCATTAG GAAGCAGCCC
1021     AGTAGTAGGT TGAGGCCGTT GAGCACCGCC GCCGCAAGGA ATGGTGCATG CAAGGAGATG
1081     GCGCCCAACA GTCCCCCGGC CACGGGGCCT GCCACCATAC CCACGCCGAA ACAAGCGCTC
1141     ATGAGCCCGA AGTGGCGAGC CCGATCTTCC CCATCGGTGA TGTCGGCGAT ATAGGCGCCA
1201     GCAACCGCAC CTGTGGCGCC GGTGATGCCG GCCACGATGC GTCCGGCGTA GAGGATCGAG
1261     ATCTCGATCC CGCGAAATTA ATACGACTCA CTATAGGGGA ATTGTGAGCG GATAACAATT
1321     CCCCTCTAGC AATAATTTTG TTTAACTTTA AGAAGGAGAC CGCGGATGGG ATCCGAATTC
1381     GTCGACGAGC TCGATTATAA GGATGATGAC GATAAATAAC TAGCATAACC CCTTGGGGCC
1441     TCTAAACGGG TCTTGAGGGG TTTTTTGTGA TGTAAAACGA CGGCCAGTTA ATACGACTCA
1501     CTATAGGGGA ATTGTGAGCG GATAACAATT CCCCTCGAAA TAATTTTGTT TAACTTTAAG
1561     AAGGAGATAT ACTATGGGTA CCAAGCTTAG TACTACCGGT TGGAGCCACC CGCAGTTCGA
1621     AAAGTAACTA GCATAACCCC TTGGGGCCTC TAAACGGGTC TTGAGGGGTT TTTTGTGACA
1681     GGAAACAGCT ATGACTAATA CGACTCACTA TAGGGGAATT GTGAGCGGAT AACAATTCCC
1741     CTCGAAATAA TTTTGTTTAA CTTTAAGAAG GAGAGATCAG ATGTCTAGAA CTAGTTACGT
1801     AGCGGCCGCT AAAGAAACCG CTGCTGCGAA ATTTGAACGC CAGCACATGG ACTCGTCTAC
1861     TAGCGCAGCT TAACTAGCAT AACCCCTTGG GGCCTCTAAA CGGGTCTTGA GGGGTTTTTT
1921     GTCTAAAAGC TGCGGAATTG TTAATACGAC TCACTATAGG GGAATTGTGA GCGGATAACA
1981     ATTCCCCTCG AAATAATTTT GTTTAACTTT AAGAAGGAGA TATACCATGG TCCATATGCT
2041     GCAGCTCGAG CACCACCACC ACCACCACTG AGATCCGGCT GCTAACAAAG CCCGAAAGGA
2101     AGCTGAGTTG GCTGCTGCCA CCGCTGAGCA ATAACTAGCA TAACCCCTTG GGGCCTCTAA
2161     ACGGGTCTTG AGGGGTTTTT TGCTGAAAGG AGGAACTATA TCCGGATTGG CGAATGGGAC
2221     GCGCCCTGTA GCGGCGCATT AAGCGCGGCG GGTGTGGTGG TTACGCGCAG CGTGACCGCT
2281     ACACTTGCCA GCGCCCTAGC GCCCGCTCCT TTCGCTTTCT TCCCTTCCTT TCTCGCCACG
2341     TTCGCCGGCT TTCCCCGTCA AGCTCTAAAT CGGGGGCTCC CTTTAGGGTT CCGATTTAGT
2401     GCTTTACGGC ACCTCGACCC CAAAAAACTT GATTAGGGTG ATGGTTCACG TAGTGGGCCA
2461     TCGCCCTGAT AGACGGTTTT TCGCCCTTTG ACGTTGGAGT CCACGTTCTT TAATAGTGGA
2521     CTCTTGTTCC AAACTGGAAC AACACTCAAC CCTATCTCGG TCTATTCTTT TGATTTATAA
2581     GGGATTTTGC CGATTTCGGC CTATTGGTTA AAAAATGAGC TGATTTAACA AAAATTTAAC
2641     GCGAATTTTA ACAAAATATT AACGTTTACA ATTTCAGGTG GCACTTTTCG GGGAAATGTG
2701     CGCGGAACCC CTATTTGTTT ATTTTTCTAA ATACATTCAA ATATGTATCC GCTCATGAAT
2761     TAATTCTTAG AAAAACTCAT CGAGCATCAA ATGAAACTGC AATTTATTCA TATCAGGATT
2821     ATCAATACCA TATTTTTGAA AAAGCCGTTT CTGTAATGAA GGAGAAAACT CACCGAGGCA
2881     GTTCCATAGG ATGGCAAGAT CCTGGTATCG GTCTGCGATT CCGACTCGTC CAACATCAAT
2941     ACAACCTATT AATTTCCCCT CGTCAAAAAT AAGGTTATCA AGTGAGAAAT CACCATGAGT
3001     GACGACTGAA TCCGGTGAGA ATGGCAAAAG TTTATGCATT TCTTTCCAGA CTTGTTCAAC
3061     AGGCCAGCCA TTACGCTCGT CATCAAAATC ACTCGCATCA ACCAAACCGT TATTCATTCG
3121     TGATTGCGCC TGAGCGAGAC GAAATACGCG ATCGCTGTTA AAAGGACAAT TACAAACAGG
3181     AATCGAATGC AACCGGCGCA GGAACACTGC CAGCGCATCA ACAATATTTT CACCTGAATC
3241     AGGATATTCT TCTAATACCT GGAATGCTGT TTTCCCGGGG ATCGCAGTGG TGAGTAACCA
3301     TGCATCATCA GGAGTACGGA TAAAATGCTT GATGGTCGGA AGAGGCATAA ATTCCGTCAG
3361     CCAGTTTAGT CTGACCATCT CATCTGTAAC ATCATTGGCA ACGCTACCTT TGCCATGTTT
3421     CAGAAACAAC TCTGGCGCAT CGGGCTTCCC ATACAATCGA TAGATTGTCG CACCTGATTG
3481     CCCGACATTA TCGCGAGCCC ATTTATACCC ATATAAATCA GCATCCATGT TGGAATTTAA
3541     TCGCGGCCTA GAGCAAGACG TTTCCCGTTG AATATGGCTC ATAACACCCC TTGTATTACT
3601     GTTTATGTAA GCAGACAGTT TTATTGTTCA TGACCAAAAT CCCTTAACGT GAGTTTTCGT
3661     TCCACTGAGC GTCAGACCCC GTAGAAAAGA TCAAAGGATC TTCTTGAGAT CCTTTTTTTC
3721     TGCGCGTAAT CTGCTGCTTG CAAACAAAAA AACCACCGCT ACCAGCGGTG GTTTGTTTGC
3781     CGGATCAAGA GCTACCAACT CTTTTTCCGA AGGTAACTGG CTTCAGCAGA GCGCAGATAC
3841     CAAATACTGT CCTTCTAGTG TAGCCGTAGT TAGGCCACCA CTTCAAGAAC TCTGTAGCAC
3901     CGCCTACATA CCTCGCTCTG CTAATCCTGT TACCAGTGGC TGCTGCCAGT GGCGATAAGT
3961     CGTGTCTTAC CGGGTTGGAC TCAAGACGAT AGTTACCGGA TAAGGCGCAG CGGTCGGGCT
4021     GAACGGGGGG TTCGTGCACA CAGCCCAGCT TGGAGCGAAC GACCTACACC GAACTGAGAT
4081     ACCTACAGCG TGAGCTATGA GAAAGCGCCA CGCTTCCCGA AGGGAGAAAG GCGGACAGGT
4141     ATCCGGTAAG CGGCAGGGTC GGAACAGGAG AGCGCACGAG GGAGCTTCCA GGGGGAAACG
4201     CCTGGTATCT TTATAGTCCT GTCGGGTTTC GCCACCTCTG ACTTGAGCGT CGATTTTTGT
4261     GATGCTCGTC AGGGGGGCGG AGCCTATGGA AAAACGCCAG CAACGCGGCC TTTTTACGGT
4321     TCCTGGCCTT TTGCTGGCCT TTTGCTCACA TGTTCTTTCC TGCGTTATCC CCTGATTCTG
4381     TGGATAACCG TATTACCGCC TTTGAGTGAG CTGATACCGC TCGCCGCAGC CGAACGACCG
4441     AGCGCAGCGA GTCAGTGAGC GAGGAAGCGG AAGAGCGCCT GATGCGGTAT TTTCTCCTTA
4501     CGCATCTGTG CGGTATTTCA CACCGCATAT ATGGTGCACT CTCAGTACAA TCTGCTCTGA
4561     TGCCGCATAG TTAAGCCAGT ATACACTCCG CTATCGCTAC GTGACTGGGT CATGGCTGCG
4621     CCCCGACACC CGCCAACACC CGCTGACGCG CCCTGACGGG CTTGTCTGCT CCCGGCATCC
4681     GCTTACAGAC AAGCTGTGAC CGTCTCCGGG AGCTGCATGT GTCAGAGGTT TTCACCGTCA
4741     TCACCGAAAC GCGCGAGGCA GCTGCGGTAA AGCTCATCAG CGTGGTCGTG AAGCGATTCA
4801     CAGATGTCTG CCTGTTCATC CGCGTCCAGC TCGTTGAGTT TCTCCAGAAG CGTTAATGTC
4861     TGGCTTCTGA TAAAGCGGGC CATGTTAAGG GCGGTTTTTT CCTGTTTGGT CACTGATGCC
4921     TCCGTGTAAG GGGGATTTCT GTTCATGGGG GTAATGATAC CGATGAAACG AGAGAGGATG
4981     CTCACGATAC GGGTTACTGA TGATGAACAT GCCCGGTTAC TGGAACGTTG TGAGGGTAAA
5041     CAACTGGCGG TATGGATGCG GCGGGACCAG AGAAAAATCA CTCAGGGTCA ATGCCAGCGC
5101     TTCGTTAATA CAGATGTAGG TGTTCCACAG GGTAGCCAGC AGCATCCTGC GATGCAGATC
5161     CGGAACATAA TGGTGCAGGG CGCTGACTTC CGCGTTTCCA GACTTTACGA AACACGGAAA
5221     CCGAAGACCA TTCATGTTGT TGCTCAGGTC GCAGACGTTT TGCAGCAGCA GTCGCTTCAC
5281     GTTCGCTCGC GTATCGGTGA TTCATTCTGC TAACCAGTAA GGCAACCCCG CCAGCCTAGC
5341     CGGGTCCTCA ACGACAGGAG CACGATCATG CGCACCCGTG GGGCCGCCAT GCCGGCGATA
5401     ATGGCCTGCT TCTCGCCGAA ACGTTTGGTG GCGGGACCAG TGACGAAGGC TTGAGCGAGG
5461     GCGTGCAAGA TTCCGAATAC CGCAAGCGAC AGGCCGATCA TCGTCGCGCT CCAGCGAAAG
5521     CGGTCCTCGC CGAAAATGAC CCAGAGCGCT GCCGGCACCT GTCCTACGAG TTGCATGATA
5581     AAGAAGACAG TCATAAGTGC GGCGACGATA GTCATGCCCC GCGCCCACCG GAAGGAGCTG
5641     ACTGGGTTGA AGGCTCTCAA GGGCATCGGT CGAGATCCCG GTGCCTAATG AGTGAGCTAA
5701     CTTACATTAA TTGCGTTGCG CTCACTGCCC GCTTTCCAGT CGGGAAACCT GTCGTGCCAG
5761     CTGCATTAAT GAATCGGCCA ACGCGCGGGG AGAGGCGGTT TGCGTATTGG GCGCCAGGGT
5821     GGTTTTTCTT TTCACCAGTG AGACGGGCAA CAGCTGATTG CCCTTCACCG CCTGGCCCTG
5881     AGAGAGTTGC AGCAAGCGGT CCACGCTGGT TT
//

 

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart