pETBlue- 2


  • Model: PVT0372
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0372   2ug


pETBlue-2 Information

Promoter: T7/lac

Copier: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid Classification: E. coli Vector; PET Series Expression Plasmid

Plasmid size: 3653bp

Plasmid label: C-HSV, C-6*His

Prokaryotic resistance: ampicillin Amp

Cloning strain: Escherichia coli DH5alpha

Culture conditions: 37 C, aerobic, LB

Expression host: Escherichia coli BL21 (DE3)

Culture conditions: 37 C, aerobic, LB

Induction: IPTG or lactose and its analogues

5'Sequencing Primers: T7: TAATACGACTCACTATAGG

3'Sequencing primers: T7-ter: TGCTAGTTATTGCTCAGCGG


pETBlue-2 Description

PETBlue-2 is a pET series expression plasmid of E. coli.The pETBlue-2 vector is designed to identify recombinants by traditional blue/white screening while also allowing T7lac promoter based expression of target genes. Screening is independent of expression because the T7lac expression promoter is in an opposed orientation relative to the E. coli promoter that mediates blue/white screening. pETBlue-2 defines the open reading frame and inserts must be cloned in-frame if expression is desired. The vector features an expanded multiple cloning site (MCS) and optional C-terminal HSV•Tag and His•Tag sequences. The sequence is numbered from the first base of the T7 promoter sequence.


pETBlue-2 Sites



pETBlue-2 Sequence

LOCUS       Exported                3653 bp ds-DNA     circular SYN 17-MAR-2013
DEFINITION  Vector for blue/white screening and for inducible bacterial
            expression of tagged proteins.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3653)
  AUTHORS   Novagen (EMD Millipore)
  TITLE     Direct Submission
COMMENT     This vector encodes a start codon that is positioned for optimal
FEATURES             Location/Qualifiers
     source          1..3653
                     /organism="synthetic DNA construct"
                     /lab_host="Escherichia coli"
                     /mol_type="other DNA"
     promoter        1..19
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     protein_bind    20..44
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             complement(54..491)
                     /gene="lacZ (truncated)"
                     /product="LacZ-alpha fragment of beta-galactosidase"
     RBS             265..270
                     /note="ribosome binding site"
     CDS             278..280
                     /product="start codon"
     misc_feature    283..298
                     /note="blunt sites"
                     /note="blunt cutter sites that allow ORF insertion in all
                     three reading frames"
     misc_feature    377..392
                     /note="blunt sites"
                     /note="blunt cutter sites that allow ORF insertion in all
                     three reading frames"
     CDS             398..430
                     /product="HSV (herpes simplex virus) epitope tag"
                     /note="HSV tag"
     CDS             437..454
                     /product="6xHis affinity tag"
     promoter        complement(541..569)
                     /note="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
     terminator      739..825
                     /gene="Escherichia coli rrnB"
                     /note="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
     terminator      917..944
                     /note="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
     terminator      1012..1059
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     rep_origin      1096..1551
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     CDS             complement(1666..2526)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2619..3207
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     protein_bind    3606..3625
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator (symmetric)"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG). The
                     symmetric lac operator was optimized for tight binding of
                     lac repressor."
        1 taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gacttacaat
       61 ttccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtacg ggcctcttcg
      121 ctattacgcc agcttgcgaa cggtgggtgc gctgcaaggc gattaagttg ggtaacgcca
      181 ggattctccc agtcacgacg ttgtaaaacg acggccagcg agagatcttg attggctagc
      241 agaataattt tgtttaactt taagaaggag atataccatg gcgatatccc gggagctcgt
      301 ggatccgaat tctgtacagg cgcgcctgca ggacgtcgac ggtaccatcg atacgcgttc
      361 gaagcttgcg gccgcacagc tgtatacacg tgcaagccag ccagaactcg ctcctgaaga
      421 cccagaggat ctcgagcacc accaccacca ccactaatgt taattaagtt gggcgttgta
      481 atcatagtca taatcaatac tcctgactgc gttagcaatt taactgtgat aaactaccgc
      541 attaaagcta ttcgatgata agctgtcaaa catgataatt cttgaagacg aaagggccta
      601 ggctgataaa acagaatttg cctggcggca gtagcgcggt ggtcccacct gaccccatgc
      661 cgaactcaga agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc catgcgagag
      721 tagggaactg ccaggcatca aataaaacga aaggctcagt cgaaagactg ggcctttcgt
      781 tttatctgtt gtttgtcggt gaacgctctc ctgagtagga caaatccgcc gggagcggat
      841 ttgaacgttg cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc ataaactgcc
      901 aggcatcaaa ttaagcagaa ggccatcctg acggatggcc tttttgcgtt tctacaaact
      961 cttttgttta tttttctaaa tacattcaaa tatgtatccg ctgagcaata actagcataa
     1021 ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg aactatatcc
     1081 ggattggcga atgggacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta
     1141 cgcgcagcgt gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc
     1201 cttcctttct cgccacgttc gccggctttc cccgtcaagc tctaaatcgg gggctccctt
     1261 tagggttccg atttagtgct ttacggcacc tcgaccccaa aaaacttgat tagggtgatg
     1321 gttcacgtag tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca
     1381 cgttctttaa tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcggtct
     1441 attcttttga tttataaggg attttgccga tttcggccta ttggttaaaa aatgagctga
     1501 tttaacaaaa atttaacgcg aattttaaca aaatattaac gtttacaatt tctggcggca
     1561 cgatggcatg agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag
     1621 ttttaaatca atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat
     1681 cagtgaggca cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc
     1741 cgtcgtgtag ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat
     1801 accgcgagac ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag
     1861 ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg
     1921 ccgggaagct agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc
     1981 tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca
     2041 acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg
     2101 tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc
     2161 actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta
     2221 ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc
     2281 aatacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg
     2341 ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc
     2401 cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc
     2461 aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat
     2521 actcatactc ttcctttttc aatcatgacc aaaatccctt aacgtgagtt ttcgttccac
     2581 tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt ttttctgcgc
     2641 gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg tttgccggat
     2701 caagagctac caactctttt tccgaaggta actggcttca gcagagcgca gataccaaat
     2761 actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct
     2821 acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga taagtcgtgt
     2881 cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc gggctgaacg
     2941 gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta
     3001 cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg
     3061 gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg aaacgcctgg
     3121 tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc
     3181 tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt acggttcctg
     3241 gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat
     3301 aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac gaccgagcgc
     3361 agcgagtcag tgagcgagga agccggcgat aatggcctgc ttctcgccga aacgtttggt
     3421 ggcgggacca gtgacgaagg cttgagcgag ggcgtgcaag attccgaata ccgcaagcga
     3481 caggccgatc atcgtcgcgc tccagcgaaa gcggtcctcg ccgaaaatga cccagagcgc
     3541 tgccggcacc tgtcctacga gttgcatgat aaagaagaca gtcataagtg cggcgacgac
     3601 cggtgaattg tgagcgctca caattctcgt gacatcataa cgtcccgcga aat


Product is for research use only!


Search name

pETBlue-2,Plasmid pETBlue-2,pETBlue-2 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
