pETM- 11


  • Model: PVT0370
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0370  2ug


pETM-11 Information

Promoter: T7/lac

Replicator: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid.

Plasmid size: 6029bp

Plasmid label: N-6 x His, N-TEV, N-MAD, C-6 * His

Prokaryotic resistance: Kanamycin/ Kan

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: BL21 (DE3)

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG


pETM-11 Description


pETM-11 Reference

1.Optimizing expression, refolding and purification of VEGFR1D2

Laura Vlijmincx S3122530 DR. A. SADRE MOMTAZ AND PROF. DR. M.R. GROVES

pETM-11 Sequence

LOCUS       Exported                6029 bp ds-DNA     circular SYN 11-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6029)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-11  
FEATURES             Location/Qualifiers
     source          1..6029
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(884..904)
                     /product="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
                     /note="TEV site"
     CDS             complement(935..952)
                     /product="6xHis affinity tag"
     protein_bind    1003..1027
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1028..1046)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1355..1432
                     /note="lacI promoter"
     CDS             1433..2515
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3324..3515
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    3617..3759
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(3945..4533)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             4655..5470
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      complement(5563..6018)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt
      181 cgacggagct cgaattcgga tccggtacca ctagttagag accaagacac gccttgtgac
      241 tgtcctgcag ctttattctc ttgatgctgg tgctggaata gccctcatca ctgccgaggc
      301 tctgcatgct gccccgctcg tcagagtcgc tcacactgct gctgctccag tccagatcac
      361 ctgtgagata gtccgtgctc tccacgtcaa cgtcgatttc ttccctgtcg gagtcggagc
      421 gctccgagga gacggtggag ccgatgctgt ccatccggat cctctcaatg cccagcttct
      481 ccagctgcct cttcaggtgt cgctgctctc gctgaagctg gtcgatttgg tgaacggctt
      541 ttctgtcaca atcttcaagt ttctttatgt gcaatttggc ttttgttaat aaactcaacg
      601 tagtgtgtcg acttgattcg ggtcccagtg gcaccagccc cttcaacttc tccaggcaca
      661 agcgaagatg agcccgtcta ttcttctcca tttcattgtg agttgatctg ctactgctgt
      721 tattcttttt ggatttgttc ctccgtttta aggcatctct gtccttgttt ttgtatggta
      781 acatggaggc ataaccatgt tcagcttctc tctcccgccg ctccagatag tcggccgcct
      841 ccagcagcat ctggatgttc atccgaaccg ccgccgccat ggcgccctga aaataaagat
      901 tctcagtagt ggggatgtcg taatcgctca tggggtgatg gtgatggtga tgtttcatgg
      961 tatatctcct tcttaaagtt aaatcaaaat tatttctaga ggggaattgt tatccgctca
     1021 caattcccct atagtgagtc gtattaattt cgcgggatcg agatctcgat cctctacgcc
     1081 ggacgcatcg tggccggcat caccggcgcc acaggtgcgg ttgctggcgc ctatatcgcc
     1141 gacatcaccg atggggaaga tcgggctcgc cacttcgggc tcatgagcgc ttgtttcggc
     1201 gtgggtatgg tggcaggccc cgtggccggg ggactgttgg gcgccatctc cttgcatgca
     1261 ccattccttg cggcggcggt gctcaacggc ctcaacctac tactgggctg cttcctaatg
     1321 caggagtcgc ataagggaga gcgtcgagat cccggacacc atcgaatggc gcaaaacctt
     1381 tcgcggtatg gcatgatagc gcccggaaga gagtcaattc agggtggtga atgtgaaacc
     1441 agtaacgtta tacgatgtcg cagagtatgc cggtgtctct tatcagaccg tttcccgcgt
     1501 ggtgaaccag gccagccacg tttctgcgaa aacgcgggaa aaagtggaag cggcgatggc
     1561 ggagctgaat tacattccca accgcgtggc acaacaactg gcgggcaaac agtcgttgct
     1621 gattggcgtt gccacctcca gtctggccct gcacgcgccg tcgcaaattg tcgcggcgat
     1681 taaatctcgc gccgatcaac tgggtgccag cgtggtggtg tcgatggtag aacgaagcgg
     1741 cgtcgaagcc tgtaaagcgg cggtgcacaa tcttctcgcg caacgcgtca gtgggctgat
     1801 cattaactat ccgctggatg accaggatgc cattgctgtg gaagctgcct gcactaatgt
     1861 tccggcgtta tttcttgatg tctctgacca gacacccatc aacagtatta ttttctccca
     1921 tgaagacggt acgcgactgg gcgtggagca tctggtcgca ttgggtcacc agcaaatcgc
     1981 gctgttagcg ggcccattaa gttctgtctc ggcgcgtctg cgtctggctg gctggcataa
     2041 atatctcact cgcaatcaaa ttcagccgat agcggaacgg gaaggcgact ggagtgccat
     2101 gtccggtttt caacaaacca tgcaaatgct gaatgagggc atcgttccca ctgcgatgct
     2161 ggttgccaac gatcagatgg cgctgggcgc aatgcgcgcc attaccgagt ccgggctgcg
     2221 cgttggtgcg gatatctcgg tagtgggata cgacgatacc gaagacagct catgttatat
     2281 cccgccgtta accaccatca aacaggattt tcgcctgctg gggcaaacca gcgtggaccg
     2341 cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc ccgtctcact
     2401 ggtgaaaaga aaaaccaccc tggcgcccaa tacgcaaacc gcctctcccc gcgcgttggc
     2461 cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
     2521 acgcaattaa tgtaagttag ctcactcatt aggcaccggg atctcgaccg atgcccttga
     2581 gagccttcaa cccagtcagc tccttccggt gggcgcgggg catgactatc gtcgccgcac
     2641 ttatgactgt cttctttatc atgcaactcg taggacaggt gccggcagcg ctctgggtca
     2701 ttttcggcga ggaccgcttt cgctggagcg cgacgatgat cggcctgtcg cttgcggtat
     2761 tcggaatctt gcacgccctc gctcaagcct tcgtcactgg tcccgccacc aaacgtttcg
     2821 gcgagaagca ggccattatc gccggcatgg cggccccacg ggtgcgcatg atcgtgctcc
     2881 tgtcgttgag gacccggcta ggctggcggg gttgccttac tggttagcag aatgaatcac
     2941 cgatacgcga gcgaacgtga agcgactgct gctgcaaaac gtctgcgacc tgagcaacaa
     3001 catgaatggt cttcggtttc cgtgtttcgt aaagtctgga aacgcggaag tcagcgccct
     3061 gcaccattat gttccggatc tgcatcgcag gatgctgctg gctaccctgt ggaacaccta
     3121 catctgtatt aacgaagcgc tggcattgac cctgagtgat ttttctctgg tcccgccgca
     3181 tccataccgc cagttgttta ccctcacaac gttccagtaa ccgggcatgt tcatcatcag
     3241 taacccgtat cgtgagcatc ctctctcgtt tcatcggtat cattaccccc atgaacagaa
     3301 atccccctta cacggaggca tcagtgacca aacaggaaaa aaccgccctt aacatggccc
     3361 gctttatcag aagccagaca ttaacgcttc tggagaaact caacgagctg gacgcggatg
     3421 aacaggcaga catctgtgaa tcgcttcacg accacgctga tgagctttac cgcagctgcc
     3481 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
     3541 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
     3601 ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga gtgtatactg
     3661 gcttaactat gcggcatcag agcagattgt actgagagtg caccatatat gcggtgtgaa
     3721 ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc
     3781 actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg
     3841 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc
     3901 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc
     3961 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga
     4021 ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc
     4081 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat
     4141 agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg
     4201 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc
     4261 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga
     4321 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact
     4381 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt
     4441 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag
     4501 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg
     4561 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgaa caataaaact
     4621 gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc
     4681 ttgctctagg ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc
     4741 tcgcgataat gtcgggcaat caggtgcgac aatctatcga ttgtatggga agcccgatgc
     4801 gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat
     4861 ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc attttatccg
     4921 tactcctgat gatgcatggt tactcaccac tgcgatcccc gggaaaacag cattccaggt
     4981 attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg
     5041 ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct
     5101 cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga
     5161 gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataaacttt tgccattctc
     5221 accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg
     5281 gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct
     5341 tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca
     5401 aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga
     5461 gtttttctaa gaattaattc atgagcggat acatatttga atgtatttag aaaaataaac
     5521 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgaaattgta aacgttaata
     5581 ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg
     5641 aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc
     5701 cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa
     5761 ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt
     5821 cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac
     5881 ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta
     5941 gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg
     6001 cgccgctaca gggcgcgtcc cattcgcca

Product is for research use only!



Search name

pETM-11,Plasmid pETM-11,pETM-11 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
