pETM- 30


  • Model: PVT0371
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0371        2ug


pETM-30 Information

Promoter: T7/lac

Replicator: ColE1 ori, F1 ori

Terminator: T7 Terminator

Plasmid classification: Escherichia coli vector; PET series expression plasmid

Plasmid size: 6346bp

Plasmid label: N-6 x His, N-GST, N-TEV, N-DCOH

Prokaryotic resistance: kanamycin Kan

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: BL21 (DE3)

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: T7-ter:TGCTAGTTATTGCTCAGCGG


pETM-30 Description

pETM-30 is a Escherichia coli vector; PET series expression plasmid with kanamycin resistance, plasmid size is 6346bp.




pETM-30 Sequence

LOCUS       Exported                6346 bp ds-DNA     circular SYN 13-8-2015
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6346)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-13  
FEATURES             Location/Qualifiers
     source          1..6346
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     source          1283..1305
                     /organism="Enterobacteria phage T7"
                     /mol_type="genomic DNA"
     terminator      26..73
                     /note="T7 terminator"
                     /note="transcription terminator for bacteriophage T7 RNA
     CDS             complement(140..157)
                     /product="6xHis affinity tag"
     CDS             complement(527..547)
                     /product="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
                     /note="TEV site"
     CDS             complement(584..1234)
                     /product="glutathione S-transferase from Schistosoma
     CDS             complement(1253..1270)
                     /product="6xHis affinity tag"
     RBS             1283..1305
                     /note="efficient ribosome binding site from bacteriophage
                     T7 gene 10 (Olins and Rangwala, 1989)"
     protein_bind    1320..1344
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1345..1363)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     promoter        1672..1749
                     /note="lacI promoter"
     CDS             1750..2832
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             3641..3832
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    3934..4076
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(4262..4850)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             4972..5787
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin in bacteria or G418
                     (Geneticin(R)) in eukaryotes"
     rep_origin      complement(5880..6335)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa
       61 ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt
      121 tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagtgcggcc gcaagcttgt
      181 cgacggagct cgaattcgga tccggtacct atgtcataga cacggcaact tgttcgatga
      241 agctggccag gtttatatcc cgttcagaaa gaccggcaca ttcgtgggtg ctcaaggtga
      301 tatggacctt gttgtacacg ttaaaccact cgggatggtg gtccagcttt tcagcctgca
      361 gggcgactct tgtcatgaag ccaaaagccc tgttgaagtc tttaaaatgg aactgtttga
      421 agatggcatc tcggccttcc agttcattcc accccacggc ccgcaggttt ggcagcagct
      481 ggtcccgttc ctcagcactc agcctgtgtg ccttgccagc catggcgccc tgaaaataaa
      541 gattctcgct catccatccg ccaccaccac cagatccact agttggagga tggtcgccac
      601 caccaaacgt ggcttgccag ccctgcaaag gccatgctat atacttgctg gatttcaagt
      661 acttatcaat ttgtgggata gcttcaatac gttttttaaa acaaactaat tttgggaacg
      721 catccaggca cattgggtcc atgtataaaa caacatcaag agcgtcatac aacatgaagt
      781 caggatgggt tacatgatca ccatttaaat atgttttatg acataaacga tcttcgaaca
      841 ttttcagcat ttcaggtagc ttgctaagaa aatcaacttt gagagtttca aagtctttac
      901 tatatgcaat tctcgaaaca ccgtatctaa tatccaaaac cgctccttca agcattgaaa
      961 tctctgcacg ctcttttgga caaccaccca acatgttgtg cttgtcagct atataacgta
     1021 tgatggccat agactgtgtt aatttaacat caccatcaat ataataagga agattgggaa
     1081 actccaaacc caattcaaac tttttgtttc gccatttatc accttcatcg cgctcataca
     1141 aatgctcttc atatttttct tcaagatatt ccaaaagaag tcgagtgggt tgcacaaggc
     1201 ccttaatttt ccaataacct agtatagggg acatggaatt gctactagtg ttgtgatggt
     1261 gatggtgatg tttcatggta tatctccttc ttaaagttaa acaaaattat ttctagaggg
     1321 gaattgttat ccgctcacaa ttcccctata gtgagtcgta ttaatttcgc gggatcgaga
     1381 tctcgatcct ctacgccgga cgcatcgtgg ccggcatcac cggcgccaca ggtgcggttg
     1441 ctggcgccta tatcgccgac atcaccgatg gggaagatcg ggctcgccac ttcgggctca
     1501 tgagcgcttg tttcggcgtg ggtatggtgg caggccccgt ggccggggga ctgttgggcg
     1561 ccatctcctt gcatgcacca ttccttgcgg cggcggtgct caacggcctc aacctactac
     1621 tgggctgctt cctaatgcag gagtcgcata agggagagcg tcgagatccc ggacaccatc
     1681 gaatggcgca aaacctttcg cggtatggca tgatagcgcc cggaagagag tcaattcagg
     1741 gtggtgaatg tgaaaccagt aacgttatac gatgtcgcag agtatgccgg tgtctcttat
     1801 cagaccgttt cccgcgtggt gaaccaggcc agccacgttt ctgcgaaaac gcgggaaaaa
     1861 gtggaagcgg cgatggcgga gctgaattac attcccaacc gcgtggcaca acaactggcg
     1921 ggcaaacagt cgttgctgat tggcgttgcc acctccagtc tggccctgca cgcgccgtcg
     1981 caaattgtcg cggcgattaa atctcgcgcc gatcaactgg gtgccagcgt ggtggtgtcg
     2041 atggtagaac gaagcggcgt cgaagcctgt aaagcggcgg tgcacaatct tctcgcgcaa
     2101 cgcgtcagtg ggctgatcat taactatccg ctggatgacc aggatgccat tgctgtggaa
     2161 gctgcctgca ctaatgttcc ggcgttattt cttgatgtct ctgaccagac acccatcaac
     2221 agtattattt tctcccatga agacggtacg cgactgggcg tggagcatct ggtcgcattg
     2281 ggtcaccagc aaatcgcgct gttagcgggc ccattaagtt ctgtctcggc gcgtctgcgt
     2341 ctggctggct ggcataaata tctcactcgc aatcaaattc agccgatagc ggaacgggaa
     2401 ggcgactgga gtgccatgtc cggttttcaa caaaccatgc aaatgctgaa tgagggcatc
     2461 gttcccactg cgatgctggt tgccaacgat cagatggcgc tgggcgcaat gcgcgccatt
     2521 accgagtccg ggctgcgcgt tggtgcggat atctcggtag tgggatacga cgataccgaa
     2581 gacagctcat gttatatccc gccgttaacc accatcaaac aggattttcg cctgctgggg
     2641 caaaccagcg tggaccgctt gctgcaactc tctcagggcc aggcggtgaa gggcaatcag
     2701 ctgttgcccg tctcactggt gaaaagaaaa accaccctgg cgcccaatac gcaaaccgcc
     2761 tctccccgcg cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa
     2821 agcgggcagt gagcgcaacg caattaatgt aagttagctc actcattagg caccgggatc
     2881 tcgaccgatg cccttgagag ccttcaaccc agtcagctcc ttccggtggg cgcggggcat
     2941 gactatcgtc gccgcactta tgactgtctt ctttatcatg caactcgtag gacaggtgcc
     3001 ggcagcgctc tgggtcattt tcggcgagga ccgctttcgc tggagcgcga cgatgatcgg
     3061 cctgtcgctt gcggtattcg gaatcttgca cgccctcgct caagccttcg tcactggtcc
     3121 cgccaccaaa cgtttcggcg agaagcaggc cattatcgcc ggcatggcgg ccccacgggt
     3181 gcgcatgatc gtgctcctgt cgttgaggac ccggctaggc tggcggggtt gccttactgg
     3241 ttagcagaat gaatcaccga tacgcgagcg aacgtgaagc gactgctgct gcaaaacgtc
     3301 tgcgacctga gcaacaacat gaatggtctt cggtttccgt gtttcgtaaa gtctggaaac
     3361 gcggaagtca gcgccctgca ccattatgtt ccggatctgc atcgcaggat gctgctggct
     3421 accctgtgga acacctacat ctgtattaac gaagcgctgg cattgaccct gagtgatttt
     3481 tctctggtcc cgccgcatcc ataccgccag ttgtttaccc tcacaacgtt ccagtaaccg
     3541 ggcatgttca tcatcagtaa cccgtatcgt gagcatcctc tctcgtttca tcggtatcat
     3601 tacccccatg aacagaaatc ccccttacac ggaggcatca gtgaccaaac aggaaaaaac
     3661 cgcccttaac atggcccgct ttatcagaag ccagacatta acgcttctgg agaaactcaa
     3721 cgagctggac gcggatgaac aggcagacat ctgtgaatcg cttcacgacc acgctgatga
     3781 gctttaccgc agctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca
     3841 gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca
     3901 gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga
     3961 tagcggagtg tatactggct taactatgcg gcatcagagc agattgtact gagagtgcac
     4021 catatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgct
     4081 cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat
     4141 cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga
     4201 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt
     4261 ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt
     4321 ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc
     4381 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa
     4441 gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct
     4501 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta
     4561 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg
     4621 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc
     4681 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta
     4741 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg
     4801 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt
     4861 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg
     4921 tcatgaacaa taaaactgtc tgcttacata aacagtaata caaggggtgt tatgagccat
     4981 attcaacggg aaacgtcttg ctctaggccg cgattaaatt ccaacatgga tgctgattta
     5041 tatgggtata aatgggctcg cgataatgtc gggcaatcag gtgcgacaat ctatcgattg
     5101 tatgggaagc ccgatgcgcc agagttgttt ctgaaacatg gcaaaggtag cgttgccaat
     5161 gatgttacag atgagatggt cagactaaac tggctgacgg aatttatgcc tcttccgacc
     5221 atcaagcatt ttatccgtac tcctgatgat gcatggttac tcaccactgc gatccccggg
     5281 aaaacagcat tccaggtatt agaagaatat cctgattcag gtgaaaatat tgttgatgcg
     5341 ctggcagtgt tcctgcgccg gttgcattcg attcctgttt gtaattgtcc ttttaacagc
     5401 gatcgcgtat ttcgtctcgc tcaggcgcaa tcacgaatga ataacggttt ggttgatgcg
     5461 agtgattttg atgacgagcg taatggctgg cctgttgaac aagtctggaa agaaatgcat
     5521 aaacttttgc cattctcacc ggattcagtc gtcactcatg gtgatttctc acttgataac
     5581 cttatttttg acgaggggaa attaataggt tgtattgatg ttggacgagt cggaatcgca
     5641 gaccgatacc aggatcttgc catcctatgg aactgcctcg gtgagttttc tccttcatta
     5701 cagaaacggc tttttcaaaa atatggtatt gataatcctg atatgaataa attgcagttt
     5761 catttgatgc tcgatgagtt tttctaagaa ttaattcatg agcggataca tatttgaatg
     5821 tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga
     5881 aattgtaaac gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt
     5941 ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat agaccgagat
     6001 agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg tggactccaa
     6061 cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac catcacccta
     6121 atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta aagggagccc
     6181 ccgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc
     6241 gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg taaccaccac
     6301 acccgccgcg cttaatgcgc cgctacaggg cgcgtcccat tcgcca

Search name

pETM-30,Plasmid pETM-30,pETM-30 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
