
  • Model: PVT10636
  • 44 Units in Stock
Ask a question

Add to Cart:


PVT10636            Packing 2ug


pEX18TC Information

Carrier name: pEX18Tc, pEX-18Tc

Plasmid type: Suicide Plasmid

High copy / low copy:

Cloning method: restriction endonuclease, polyclonal site

Promoter: Lac

Carrier size: 6349 BP

5'sequencing primers and sequences: M13F (-47) CGCCAGGGTTTTCCCAGTCACGAC

3'sequencing primers and sequences: M13R (-48) AGCGGATAACAATTTCACACAGGA

Carrier resistance: tetracycline

Virus / non virus: non viral

Function E.coli Editing plasmids


pEX18TC Reference
1. Biswas I., Mettlach J. (2019) Targeted Gene Replacement in Acinetobacter baumannii. In: Biswas I., Rather P. (eds) Acinetobacter baumannii. Methods in Molecular Biology, vol 1946. Humana Press, New York, NY

Publisher Name    Humana Press, New York, NY


Cloning vector pEX18Tc, complete sequence

LOCUS       AF047519                6349 bp    DNA     circular SYN 25-NOV-2003
DEFINITION  Cloning vector pEX18Tc, complete sequence.
VERSION     AF047519.1
SOURCE      Cloning vector pEX18Tc
  ORGANISM  Cloning vector pEX18Tc
            other sequences; artificial sequences; vectors.
REFERENCE   1  (bases 1 to 6349)
  AUTHORS   Hoang,T.T., Karkhoff-Schweizer,R.R., Kutchma,A.J. and
  TITLE     A broad-host-range Flp-FRT recombination system for site-specific
            excision of chromosomally-located DNA sequences: application for
            isolation of unmarked Pseudomonas aeruginosa mutants
  JOURNAL   Gene 212 (1), 77-86 (1998)
   PUBMED   9661666
REFERENCE   2  (bases 1 to 6349)
  AUTHORS   Hoang,T.T., Karkhoff-Schweizer,R.R., Kutchma,A.J. and
  TITLE     Direct Submission
  JOURNAL   Submitted (10-FEB-1998) Microbiology, Colorado State University,
            Fort Collins, CO 80523, USA
FEATURES             Location/Qualifiers
     source          1..6349
                     /organism="Cloning vector pEX18Tc"
                     /mol_type="genomic DNA"
     gene            complement(209..1630)
     CDS             complement(209..1630)
                     /product="levansucrase precursor"
     oriT            2104..2928
     regulatory      complement(2980..3006)
     regulatory      complement(3139..3182)
     rRNA            complement(3186..3305)
                     /product="Eschericia coli 5S ribosomal RNA"
     gene            complement(3341..3625)
     CDS             complement(3341..3625)
                     /product="lac alpha peptide"
     gene            complement(4885..6075)
     CDS             complement(4885..6075)
                     /product="tetracycline efflux protein"
        1 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
       61 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
      121 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
      181 accataatcg gcattttctt ttgcgttttt atttgttaac tgttaattgt ccttgttcaa
      241 ggatgctgtc tttgacaaca gatgttttct tgcctttgat gttcagcagg aagctaggcg
      301 caaacgttga ttgtttgtct gcgtagaatc ctctgtttgt catatagctt gtaatcacga
      361 cattgtttcc tttcgcttga ggtacagcga agtgtgagta agtaaaggtt acatcgttag
      421 gatcaagatc catttttaac acaaggccag ttttgttcag cggcttgtat gggccagtta
      481 aagaattaga aacataacca agcatgtaaa tatcgttaga cgtaatgccg tcaatcgtca
      541 tttttgatcc gcgggagtca gtgaacagat accatttgcc gttcatttta aagacgttcg
      601 cgcgttcaat ttcatctgtt actgtgttag atgcaatcag cggtttcatc acttttttca
      661 gtgtgtaatc atcgtttagc tcaatcatac cgagagcgcc gtttgctaac tcagccgtgc
      721 gttttttatc gctttgcaga agtttttgac tttcttgacg gaagaatgat gtgcttttgc
      781 catagtatgc tttgttaaat aaagattctt cgccttggta gccatcttca gttccagtgt
      841 ttgcttcaaa tactaagtat ttgtggcctt tatcttctac gtagtgagga tctctcagcg
      901 tatggttgtc gcctgagctg tagttgcctt catcgatgaa ctgctgtaca ttttgatacg
      961 tttttccgtc accgtcaaag attgatttat aatcctctac accgttgatg ttcaaagagc
     1021 tgtctgatgc tgatacgtta acttgtgcag ttgtcagtgt ttgtttgccg taatgtttac
     1081 cggagaaatc agtgtagaat aaacggattt ttccgtcaga tgtaaatgtg gctgaacctg
     1141 accattcttg tgtttggtct tttaggatag aatcatttgc atcgaatttg tcgctgtctt
     1201 taaagacgcg gccagcgttt ttccagctgt caatagaagt ttcgccgact ttttgataga
     1261 acatgtaaat cgatgtgtca tccgcatttt taggatctcc ggctaatgca aagacgatgt
     1321 ggtagccgtg atagtttgcg acagtgccgt cagcgttttg taatggccag ctgtcccaaa
     1381 cgtccaggcc ttttgcagaa gagatatttt taattgtgga cgaatcgaac tcaggaactt
     1441 gatatttttc atttttttgc tgttcaggga tttgcagcat atcatggcgt gtaatatggg
     1501 aaatgccgta tgtttcctta tatggctttt ggttcgtttc tttcgcaaac gcttgagttg
     1561 cgcctcctgc cagcagtgcg gtagtaaagg ttaatactgt tgcttgtttt gcaaactttt
     1621 tgatgttcat cgttcatgtc tcctttttta tgtactgtgt tagcggtctg cttcttccag
     1681 ccctcctgtt tgaagatggc aagttagtta cgcacaataa aaaaagacct aaaatatgta
     1741 aggggtgacg ccaaagtata cactttgccc tttacacatt ttaggtcttg cctgctttat
     1801 cagtaacaaa cccgcgcgat ttacttttcg acctcattct attagactct cgtttggatt
     1861 gcaactggtc tattttcctc ttttgtttga tagaaaatca taaaaggatt tgcagactac
     1921 gggcctaaag aactaaaaaa tctatctgtt tcttttcatt ctctgtattt tttatagttt
     1981 ctgttgcatg ggcataaagt tgccttttta atcacaattc agaaaatatc ataatatctc
     2041 atttcactaa ataatagtga acggcaggta tatgtgatgg gttaaaaagg atcgatcctc
     2101 tagctagagt cgatcttcgc cagcagggcg aggatcgtgg catcaccgaa ccgcgccgtg
     2161 cgcgggtcgt cggtgagcca gagtttcagc aggccgccca ggcggcccag gtcgccattg
     2221 atgcgggcca gctcgcggac gtgctcatag tccacgacgc ccgtgatttt gtagccctgg
     2281 ccgacggcca gcaggtaggc cgacaggctc atgccggccg ccgccgcctt ttcctcaatc
     2341 gctcttcgtt cgtctggaag gcagtacacc ttgataggtg ggctgccctt cctggttggc
     2401 ttggtttcat cagccatccg cttgccctca tctgttacgc cggcggtagc cggccagcct
     2461 cgcagagcag gattcccgtt gagcaccgcc aggtgcgaat aagggacagt gaagaaggaa
     2521 cacccgctcg cgggtgggcc tacttcacct atcctgcccg gctgacgccg ttggatacac
     2581 caaggaaagt ctacacgaac cctttggcaa aatcctgtat atcgtgcgaa aaaggatgga
     2641 tataccgaaa aaatcgctat aatgaccccg aagcagggtt atgcagcgga aaagcgctgc
     2701 ttccctgctg ttttgtggaa tatctaccga ctggaaacag gcaaatgcag gaaattactg
     2761 aactgagggg acaggcgaga gacgatgcca aagagctaca ccgacgagct ggccgagtgg
     2821 gttgaatccc gcgcggccaa gaagcgccgg cgtgatgagg ctgcggttgc gttcctggcg
     2881 gtgagggcgg atgtcgatat gcgtaaggag aaaataccgc atcaggcgca tatttgaatg
     2941 tatttagaaa aataaacaaa aagagtttgt agaaacgcaa aaaggccatc cgtcaggatg
     3001 gccttctgct taatttgatg cctggcagtt tatggcgggc gtcctgcccg ccaccctccg
     3061 ggccgttgct tcgcaacgtt caaatccgct cccggcggat ttgtcctact caggagagcg
     3121 ttcaccgaca aacaacagat aaaacgaaag gcccagtctt tcgactgagc ctttcgtttt
     3181 atttgatgcc tggcagttcc ctactctcgc atggggagac cccacactac catcggcgct
     3241 acggcgtttc acttctgagt tcggcatggg gtcaggtggg accaccgcgc tactgccgcc
     3301 aggcaaattc tgttttatca gaccgcttct gcgttctgat ttaatctgta tcaggctgaa
     3361 aatcttctct catccgccaa aacagccaag ctcgccattc gccattcagg ctgcgcaact
     3421 gttgggaagg gcgatcggtg cgggcctctt cgctattacg ccagctggcg aaagggggat
     3481 gtgctgcaag gcgattaagt tgggtaacgc cagggttttc ccagtcacga cgttgtaaaa
     3541 cgacggccag tgccaagctt gcatgcctgc aggtcgactc tagaggatcc ccgggtaccg
     3601 agctcgaatt cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca
     3661 attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg
     3721 agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg
     3781 tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc
     3841 tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta
     3901 tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag
     3961 aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg
     4021 tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg
     4081 tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg
     4141 cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga
     4201 agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc
     4261 tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt
     4321 aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact
     4381 ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg
     4441 cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt
     4501 accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt
     4561 ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct
     4621 ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg
     4681 gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt
     4741 aaatcaatct aaagtatata tgagtaaact tggtctgaca atcgatgcaa gggttggttt
     4801 gcgcattcac agttctccgc aagaattgat tggctccaat tcttggagtg gtgaatccgt
     4861 tagcgaggtg ccgccggctt ccattcaggt cgaggtggcc cggctccatg caccgcgacg
     4921 caacgcgggg aggcagacaa ggtatagggc ggcgcctaca atccatgcca acccgttcca
     4981 tgtgctcgcc gaggcggcat aaatcgccgt gacgatcagc ggtccagtga tcgaagttag
     5041 gctggtaaga gccgcgagcg atccttgaag ctgtccctga tggtcgtcat ctacctgcct
     5101 ggacagcatg gcctgcaacg cgggcatccc gatgccgccg gaagcgagaa gaatcataat
     5161 ggggaaggcc atccagcctc gcgtcgcgaa cgccagcaag acgtagccca gcgcgtcggc
     5221 cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg gaccagtgac
     5281 gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc cgatcatcgt
     5341 cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg gcacctgtcc
     5401 tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca tgccccgcgc
     5461 ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcggc gctctccctt
     5521 atgcgactcc tgcattagga agcagcccag tagtaggttg aggccgttga gcaccgccgc
     5581 cgcaaggaat ggtgcatgta aggagatggc gcccaacagt cccccggcca cggggcctgc
     5641 caccataccc acgccgaaac aagcgctcat gagcccgaag tggcgagccc gatcttcccc
     5701 atcggtgatg tcggcgatat aggcgccagc aaccgcacct gtggcgccgg tgatgccggc
     5761 cacgatgcgt ccggcgtaga gaatccacag gacgggtgtg gtcgccatga tcgcgtagtc
     5821 gatagtggct ccaagtagcg aagcgagcag gactgggcgg cggccaaagc ggtcggacag
     5881 tgctccgaga acgggtgcgc atagaaattg catcaacgca tatagcgcta gcagcacgcc
     5941 atagtgactg gcgatgctgt cggaatggac gatatcccgc aagaggcccg gcagtaccgg
     6001 cataaccaag cctatgccta cagcatccag ggtgacggtg ccgaggatga cgatgagcgc
     6061 attgttagat ttcatacacg gtgcctgact gcgttagcaa tttaactgtg ataaactacc
     6121 gcattaaagc taatcggttg aatactcata ctcttccttt ttcaatatta ttgaagcatt
     6181 tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa
     6241 ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt
     6301 atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtc

Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
