pEYFP- C1 Plasmid


  • Model: PVT1223
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEYFP-C1,Plasmid pEYFP-C1,pEYFP-C1 vector


pEYFP-C1 Information

Promoter: CMV

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid size: 4731bp

Prokaryotic resistance: Kan

Screening markers: Neo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: pEGFP-C-5:CATGGTCCTGCTGGAGTTCGTG

3'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC


pEYFP-C1 Description

pEYFP-C1 encodes an enhanced yellow-green variant of the Aequorea victoria green fluorescent protein (GFP). The EYFP gene contains the four amino acid substitutions previously published as GFP-10C (1): Ser-65 to Gly; Val-68 to Leu; Ser-72 to Ala; and and Thr-203 to Tyr. The fluorescence excitation maximum of EYFP is 513 nm; the emission spectrum has a peak at 527 nm (in the yellow-green region). When excited at 513-nm, the Eof EYFP is 36,500 cm­1M­1 and the fluorescent quantum yield is 0.63 (1), resulting in a bright fluorescent signal. The fluorescence observed is roughly equivalent to that from EGFP.



pEYFP-C1 Sequence

LOCUS       Exported                4731 bp ds-DNA     circular SYN 01-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4731)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, September 1, 2016  
FEATURES             Location/Qualifiers
     source          1..4731
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     CDS             613..1329
                     /product="enhanced YFP"
                     /note="mammalian codon-optimized"
     misc_feature    1330..1395
                     /note="multiple cloning site"
     polyA_signal    1519..1640
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1647..2102)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2129..2233
                     /note="AmpR promoter"
     promoter        2235..2592
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2443..2578
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2627..3421
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3653..3700
                     /note="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase 
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      4029..4617
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta
      601 ccggtcgcca ccatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg
      661 gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc
      721 gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg
      781 ccctggccca ccctcgtgac caccttcggc tacggcctgc agtgcttcgc ccgctacccc
      841 gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag
      901 cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag
      961 ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac
     1021 atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat catggccgac
     1081 aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc
     1141 gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg
     1201 cccgacaacc actacctgag ctaccagtcc gccctgagca aagaccccaa cgagaagcgc
     1261 gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag
     1321 ctgtacaagt ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc
     1381 gcgggcccgg gatccaccgg atctagataa ctgatcataa tcagccatac cacatttgta
     1441 gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa acataaaatg
     1501 aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat
     1561 agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc
     1621 aaactcatca atgtatctta
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
