pEYFP- N1 Plasmid


  • Model: PVT1222
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pEYFP-N1,Plasmid pEYFP-N1,pEYFP-N1 vector



pEYFP-N1 Information

Promoter: CMV

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, fluorescent protein reporter vectors

Plasmid size: 4733bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: pEGFP-C-5:CATGGTCCTGCTGGAGTTCGTG

Primers for 3'sequencing: primers designed based on sequences


pEYFP-N1 Description

pEYFP-N1 encodes an enhanced yellow-green variant of the Aequorea victoria green fluorescent protein (GFP). The EYFP gene contains four amino acid substitutions previously published as GFP-10C (1). The fluorescence excitation maximum of EYFP is 513 nm, and the emission spectrum has a peak at 527 nm (in the yellow-green region). When excited at 513 nm, the Em of EYFP is 36,500 cm–1M–1 and the fluorescence quantum yield is 0.63 (1), resulting in a bright fluorescent signal. The fluorescence level observed from EYFP is roughly equivalent to that from EGFP.


pEYFP-N1 Multiple cloning site




pEYFP-N1 Sequence

LOCUS       Exported File           4733 bp ds-DNA    circular SYN 25-1-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4733)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-1-25 from SnapGene 2.0.1
FEATURES             Location/Qualifiers
     source          1..4733
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        61..364
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        365..568
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     misc_feature    591..671
                     /note="multiple cloning site"
     CDS             679..1398
                     /product="enhanced YFP"
                     /note="mammalian codon-optimized"
     polyA_signal    1521..1642
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1649..2104)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        2131..2235
                     /note="AmpR promoter"
     promoter        2237..2594
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2445..2580
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2629..3423
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3655..3702
                     /note="HSV TK poly(A) signal"
                     /note="herpesvirus thymidine kinase polyadenylation signal"
     rep_origin      4031..4619
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg
       61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt
      121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca
      181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc
      241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta
      301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac
      361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg
      421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg
      481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt
      541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta
      601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg
      661 gatccaccgg tcgccaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc
      721 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc
      781 gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg
      841 cccgtgccct ggcccaccct cgtgaccacc ttcggctacg gcctgcagtg cttcgcccgc
      901 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc
      961 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag
     1021 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac
     1081 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg
     1141 gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac
     1201 ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg
     1261 ctgctgcccg acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag
     1321 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg
     1381 gacgagctgt acaagtaaag cggccgcgac tctagatcat aatcagccat accacatttg
     1441 tagaggtttt acttgcttta aaaaacctcc cacacctccc cctgaacctg aaacataaaa
     1501 tgaatgcaat tgttgttgtt aacttgttta ttgcagctta taatggttac aaataaagca
     1561 atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt
     1621 ccaaactcat caatgtatct taaggcgtaa attgtaagcg ttaatatttt gttaaaattc
     1681 gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc
     1741 ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
