pEYFP

$280.00

  • Model: PVTY01056
  • 20 Units in Stock
Ask a question


Add to Cart:

pEYFP

PVTY01056  2ug

pEYFP Description

Plasmid type: Fluorescent protein reporter vector Size: 3355 bp 5' Sequencing primers and sequences: EGFP-N:5'd[CGTCGCCGTCCAGCTCGACCAG]3' Resistance(s): Ampicillin (Amp) Note: Yellow variant of GFP tag

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart