pFastBac Dual

$280.00

  • Model: PVTY01061
  • 20 Units in Stock
Ask a question


Add to Cart:

pFastBac Dual

PVTY01061  2ug

pFastBac Dual Description

Plasmid type: Insect cell expression vector Promoter: Polyhedrin, P10 Copy number: High copy Cloning Method: Multiple cloning sites,restriction endonuclease Size: 5238 bp 5' sequencing primers: pFastbac-F: TATTCCGGATTATTCATACC 3' sequencing primers: pFastBac-R: ACAAATGTGGTATGGCTGA Resistance(s): Ampicillin (Amp) Selectable markers: Gentamicin (Gentamicin) Note: This vector can express two genes simultaneously in insect cells.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart