pFastBac- GST- C Plasmid


  • Model: PVT5111
  • 48 Units in Stock
Ask a question

Add to Cart:


Search name

pFastBac-GST-C,Plasmid pFastBac-GST-C,pFastBac-GST-C vector


pFastBac-GST-C Information

Promoter: Polyhedrin

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: insect cell carrier; baculovirus expression plasmid.

Plasmid size: 5468bp

Plasmid label: N-3C, N-GST

Prokaryotic resistance: ampicillin Ampicillin

Screening markers: gentamicin Gentamicin

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: insect cells

Induction mode: constituent expression without induction

5'sequencing primers: pFastbac-F: TATTCCGGATTATTCATACC

3'sequencing primers: pFastBac-R: ACAAATGTGGTATGGCTGA

Note: the expression of GST fusion protein

Use:Insect cell plasmid


pFastBac-GST-C Description

The Bac-to-Bac Baculovirus Expression System provides a rapid and efficient method to generate recombinant baculoviruses (Ciccarone et al., 1997). This method was developed by researchers at Monsanto, and is based on site-specific transposition of an expression cassette into a baculovirus shuttle vector (bacmid) propagated in E. coli (Luckow et al., 1993). The major components of the Bac-to-Bac Baculovirus Expression System include:
        • A choice of pFastBac™ donor plasmids that allow generation of an expression construct containing the gene of interest where expression of the gene of interest is controlled by a baculovirus-specific promoter.
        • An E. coli host strain, DH10Bac™, that contains a baculovirus shuttle vector (bacmid) and a helper plasmid, and allows generation of a recombinant bacmid following transposition of the pFastBac™ expression construct.



pFastBac-GST-C Sequence

LOCUS       Exported                5468 bp ds-DNA     circular SYN 07-MAR-2012
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5468)
  TITLE     Direct Submission
  JOURNAL   Exported Friday, August 26, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5468
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      2..457
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        484..588
                     /note="AmpR promoter"
     CDS             589..1449
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1620..2208
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     mobile_element  2511..2735
                     /note="mini-Tn7 element (right end of the Tn7 transposon)"
     CDS             complement(2802..3335)
                     /product="gentamycin acetyltransferase"
                     /note="confers resistance to gentamycin"
     promoter        complement(3524..3552)
                     /gene="intI1 (promoter lies within the coding sequence)"
                     /note="Pc promoter"
                     /note="class 1 integron promoter"
     promoter        3904..3995
                     /gene="polh from Autographa californica"
                     /note="polyhedrin promoter"
                     /note="promoter for the baculovirus polyhedrin gene"
     CDS             4097..4750
                     /product="glutathione S-transferase from Schistosoma 
     CDS             4757..4780
                     /product="recognition and cleavage site for human 
                     rhinovirus 3C and PreScission proteases"
                     /note="HRV 3C site"
     polyA_signal    4958..5092
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     mobile_element  5121..5286
                     /note="mini-Tn7 element (left end of the Tn7 transposon)"
        1 gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc
       61 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc
      121 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt
      181 agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg
      241 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
      301 ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta
      361 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt
      421 aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat
      481 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg
      541 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa
      601 catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac
      661 ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac
      721 atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
