pFastBac- GST- N Plasmid


  • Model: PVT5110
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pFastBac-GST-N,Plasmid pFastBac-GST-N,pFastBac-GST-N vector

pFastBac-GST-N Plasmid information

Promoter: Polyhedrin
Replicon: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: insect cell vector and baculovirus expression plasmid
Plasmid size: 5463bp
Plasmid Tags: C-3C, C-GST
Prokaryotic resistance: ampicillin Ampicillin
Screening marker: gentamicin Gentamicin
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expressing host: insect cells
Induction: constitutive expression, without induction
Primers for 5'sequencing: pFastbac-F: TATTCCGGATTATTCATACC
Primers for 3'sequencing: pFastBac-R: ACAAATGTGGTATGGCTGA
Remark: GST fusion protein can be expressed
Use:Insect cell plasmid


pFastBac-GST-N Plasmid Description

The Bac-to-Bac® Baculovirus Expression System provides a rapid and efficient method to generate recombinant baculoviruses (Ciccarone et al., 1997). This method was developed by researchers at Monsanto, and is based on site-specific transposition of an expression cassette into a baculovirus shuttle vector (bacmid) propagated in E. coli (Luckow et al., 1993). The major components of the Bac-to-Bac® Baculovirus Expression System include:
        • A choice of pFastBac™ donor plasmids that allow generation of an expression construct containing the gene of interest where expression of the gene of interest is controlled by a baculovirus-specific promoter.
        • An E. coli host strain, DH10Bac™, that contains a baculovirus shuttle vector (bacmid) and a helper plasmid, and allows generation of a recombinant bacmid following transposition of the pFastBac expression construct.

pFastBac-GST-N Plasmid Sequence

LOCUS       Exported                5463 bp ds-DNA     circular SYN 26-AUG-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5463)
  TITLE     Direct Submission
  JOURNAL   Exported Friday, August 26, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5463
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      2..457
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        484..588
                     /note="AmpR promoter"
     CDS             589..1449
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1620..2208
                     /note="pUC ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     mobile_element  2511..2735
                     /note="mini-Tn7 element (right end of the Tn7 transposon)"
     CDS             complement(2802..3335)
                     /product="gentamycin acetyltransferase"
                     /note="confers resistance to gentamycin"
     promoter        complement(3524..3552)
                     /gene="intI1 (promoter lies within the coding sequence)"
                     /note="Pc promoter"
                     /note="class 1 integron promoter"
     promoter        3904..3995
                     /gene="polh from Autographa californica"
                     /note="polyhedrin promoter"
                     /note="promoter for the baculovirus polyhedrin gene"
     CDS             4137..4160
                     /product="recognition and cleavage site for human 
                     rhinovirus 3C and PreScission proteases"
                     /note="HRV 3C site"
     CDS             4167..4823
                     /product="glutathione S-transferase from Schistosoma 
     polyA_signal    4953..5087
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     mobile_element  5116..5281
                     /note="mini-Tn7 element (left end of the Tn7 transposon)"
        1 gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc
       61 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc
      121 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt
      181 agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg
      241 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
      301 ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta
      361 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt
      421 aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat
      481 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg
      541 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
