pFastBac-GST-N

Search name

pFastBac-GST-N,Plasmid pFastBac-GST-N,pFastBac-GST-N vector

pFastBac-GST-N Plasmid information

Promoter: Polyhedrin
Replicon: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: insect cell vector and baculovirus expression plasmid
Plasmid size: 5463bp
Plasmid Tags: C-3C, C-GST
Prokaryotic resistance: ampicillin Ampicillin
Screening marker: gentamicin Gentamicin
Clone strain: DH5 alpha
Culture conditions: 37, aerobic, LB
Expressing host: insect cells
Induction: constitutive expression, without induction
Primers for 5'sequencing: pFastbac-F: TATTCCGGATTATTCATACC
Primers for 3'sequencing: pFastBac-R: ACAAATGTGGTATGGCTGA
Remark: GST fusion protein can be expressed
Use:Insect cell plasmid

pFastBac-GST-N Plasmid Description

The Bac-to-Bac® Baculovirus Expression System provides a rapid and efficient method to generate recombinant baculoviruses (Ciccarone et al., 1997). This method was developed by researchers at Monsanto, and is based on site-specific transposition of an expression cassette into a baculovirus shuttle vector (bacmid) propagated in E. coli (Luckow et al., 1993). The major components of the Bac-to-Bac® Baculovirus Expression System include:
        • A choice of pFastBac™ donor plasmids that allow generation of an expression construct containing the gene of interest where expression of the gene of interest is controlled by a baculovirus-specific promoter.
        • An E. coli host strain, DH10Bac™, that contains a baculovirus shuttle vector (bacmid) and a helper plasmid, and allows generation of a recombinant bacmid following transposition of the pFastBac expression construct.

pFastBac-GST-N Plasmid Sequence