pFastBac1 Plasmid


  • Model: PVT5101
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pFastBac1,Plasmid pFastBac1,pFastBac1 vector


pFastBac1 Informaiton

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: wide host series, insect cell carrier

Plasmid size: 4776bp

Prokaryotic resistance: Amp

Selection marker: Gen

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: insect cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: pFastbac-F: TATTCCGGATTATTCATACC

3'sequencing primers: pFastBac-R: ACAAATGTGGTATGGCTGA


pFastBac1 Description

pFastBac1 is a non-fusion protein expression vector, and there are no other fusion protein tags in the vector. In order to ensure the correct expression of the target gene, the inserted fragment must contain the ATG initiation codon to ensure the translation of the protein initiation. Insert fragments preferably contain stop codons, ensuring that proteins do not translate redundant amino acids. In the polyclonal sites of pFastBacI vectors, termination codons are included in all three reading frame distributions.


pFastBac1 Sequence

LOCUS       Exported                4776 bp ds-DNA     circular SYN 13-1-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4776)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-1-13 
FEATURES             Location/Qualifiers
     source          1..4776
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      2..457
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        484..588
                     /note="AmpR promoter"
     CDS             589..1449
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1620..2208
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     mobile_element  2511..2735
                     /note="mini-Tn7 element (right end of the Tn7 transposon)"
     CDS             complement(2802..3335)
                     /product="gentamycin acetyltransferase"
                     /note="confers resistance to gentamycin"
     promoter        complement(3524..3552)
                     /gene="intI1 (promoter lies within the coding sequence)"
                     /note="Pc promoter"
                     /note="class 1 integron promoter"
     promoter        3904..3995
                     /gene="polh from Autographa californica"
                     /note="polyhedrin promoter"
                     /note="promoter for the baculovirus polyhedrin gene"
     misc_feature    4032..4142
     polyA_signal    4266..4400
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     mobile_element  4429..4594
                     /note="mini-Tn7 element (left end of the Tn7 transposon)"
        1 gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc
       61 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc
      121 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt
      181 agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg
      241 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
      301 ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta
      361 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt
      421 aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat
      481 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg
      541 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa
      601 catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac
      661 ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac
      721 atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt
      781 ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc
      841 gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca
      901 ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc
      961 ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag
     1021 gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa
     1081 ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg
     1141 gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa
     1201 ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg
     1261 gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt
     1321 gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt
     1381 caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag
     1441 cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat
     1501 ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct
     1561 taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct
     1621 tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca
     1681 gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc
     1741 agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc
     1801 aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct
     1861 gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag
     1921 gcgca
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
