pFastBacHT A

$280.00

  • Model: PVTY01064
  • 20 Units in Stock
Ask a question


Add to Cart:

pFastBacHT A

PVTY01064  2ug

pFastBacHT A Description

Plasmid type: Insect cell expression vector Promoter: Polyhedrin Copy number: High copy Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4856 bp 5' sequencing primers: pFastbac-F: TATTCCGGATTATTCATACC 3' sequencing primers: pFastBac-R: ACAAATGTGGTATGGCTGA Tags: N-His, N-TEV Resistance(s): Ampicillin (Amp) Selectable markers: Gentamicin Gentamicin

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart