pFastBacHTB Plasmid


  • Model: PVT5104
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pFastBacHTB,Plasmid pFastBacHTB,pFastBacHTB vector


pFastBacHTB Informaiton

Promoter: PC, polyhedrin

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: the wide host series, insect cell carrier

Plasmid size: 4857bp

Plasmid label: N-His; N-TEV

Prokaryotic resistance: Amp

Screening markers: Gen

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: insect cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: pFastbac-F: TATTCCGGATTATTCATACC

3'sequencing primers: pFastBac-R: ACAAATGTGGTATGGCTGA


pFastBacHTB Description

The pFastBac HT vector is supplied with the multiple cloning site in three reading frames (A, B, and C) to facilitate cloning your gene of interest in frame with the N-terminal 6xHis tag.




pFastBacHTB Sequence

LOCUS       Exported                4857 bp ds-DNA     circular SYN 09-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4857)
  TITLE     Direct Submission
  JOURNAL   Exported Friday, September 9, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4857
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      2..457
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     promoter        484..588
                     /note="AmpR promoter"
     CDS             589..1449
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      1620..2208
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     mobile_element  2511..2735
                     /note="mini-Tn7 element (right end of the Tn7 transposon)"
     CDS             complement(2802..3335)
                     /product="gentamycin acetyltransferase"
                     /note="confers resistance to gentamycin"
     promoter        complement(3524..3552)
                     /gene="intI1 (promoter lies within the coding sequence)"
                     /note="Pc promoter"
                     /note="class 1 integron promoter"
     promoter        3904..3995
                     /gene="polh from Autographa californica"
                     /note="polyhedrin promoter"
                     /note="promoter for the baculovirus polyhedrin gene"
     CDS             4062..4079
                     /product="6xHis affinity tag"
     CDS             4101..4121
                     /product="tobacco etch virus (TEV) protease recognition and
                     cleavage site"
                     /note="TEV site"
     polyA_signal    4347..4481
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     mobile_element  4510..4675
                     /note="mini-Tn7 element (left end of the Tn7 transposon)"
        1 gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc
       61 gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc
      121 acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt
      181 agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg
      241 ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt
      301 ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta
      361 taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt
      421 aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt tcggggaaat
      481 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg
      541 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa
      601 catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac
      661 ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac
      721 atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt
      781 ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc
      841 gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca
      901 ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc
      961 ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag
     1021 gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa
     1081 ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg
     1141 gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa
     1201 ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg
     1261 gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
