pFC332

$160.00

  • Model: PVT11346
  • 48 Units in Stock
Ask a question


Add to Cart:

pFC332


Catalog No. PVT11346
Packing 2ug

 

pFC332 Information
Function /
Resistance Amp
Screen Hyg
Strain Stbl3
Culture temperature 37degrees centigrade

 

pFC332 Sequence
ACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTG
TAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGCGCTGCGATGATACCGCGAGAACCACGCTCACCGGCTCC
GGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGT
CTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATCGCTACAGGC
ATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCC
CATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCA
TGGTTATGGCAGCGCTACATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACC
AAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAG
CAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCA
GTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACA
GGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATATTCTTCCTTTTTCAATATTA
TTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTCA
GTGTTACAACCAATTAACCAATTCTGAACATTATCGCGAGCCCATTTATACCTGAATATGGCTCATAACACCCCTTGTTT
GCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGATGGTAGTG
TGGGGACTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCG
CCCGGGCTAATTATGGGGTGTCGCCCTTATTCGACTCTATAGTGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGA
AGTGGGGATTTAAATGCGGCCGCGCTGAGGGTTTAATCGACGAAGCAGCTGACGGCCAGTGCCAAGCTTAACGCGTACCG
GGCCCAGTATATGTTCCGCAGATGACTGGAGCTCTGCCATACGTGCCCTCTCAAGCACCATTTGTTCCATCTACAGAGAC
TAGTCACCAACTAGTCTATCAAGACTCACAGGGTACATTGCTGAGACCAACTGACCAGAGGCAGGGTAGCGGATTGACGG
CTCCATCTCCTTCACTTACAAGGTCTATTGAAAGCCCTTTAGCATCACCAAGCGGAGAATAGATTGTTAAGCTTATTTTT
TGTATACTGTTTTGTGATAGCACGAAGTTTTTCCACGGTATCTTGTTAAAAATATATATTTGTGGCGGGCTTACCTACAT
CAAATTAATAAGAGACTAATTATAAACTAAACACACAAGCAAGCTACTTTAGGGTAAAAGTTTATAAATGCTTTTGACGT
ATAAACGTTGCTTGTATTTATTATTACAATTAAAGGTGGATAGAAAACCTAGAGACTAGTTAGAAACTAATCTCAGGTTT
GCGTTAAACTAAATCAGAGCCCGAGAGGTTAACAGAACCTAGAAGGGGACTAGATATCCGGGTAGGGAAACAAAAAAAAA
AANCAAGACAGCCACATATTAGGGAGACTAGTTAGAAGCTAGTTCCAGGACTAGGAAAATAAAAGACAATGATACCACAG
TCTAGTTGACAACTAGATAGATTCTAGATTGAGGCCAAAGTCTCTGAGATCCAGGTTAGTTGCAACTAATACTAGTTAGT
ATCTAGTCTCCTATAACTCTGAAGCTAGAATAACTTACTACTATTATCCTCACCACTGTTCAGCTGCGCAAACGGAGTGA
TTGCAAGGTGTTCAGAGACTAGTTATTGACTAGTCAGTGACTAGCAATAACTAACAAGGTATTAACCTACCATGTCTGCC
ATCACCCTGCACTTCCTCGGGCTCAGCAGCCTTTTCCTCCTCATTTTCATGCTCATTTTCCTTGTTTAAGACTGTGACTA
GTCAAAGACTAGTCCAGAACCACAAAGGAGAAATGTCTTACCACTTTCTTCATTGCTTGTCTCTTTTGCATTATCCATGT
CTGCAACTAGTTAGAGTCTAGTTAGTGACTAGTCCGACGAGGACTTGCTTGTCTCCGGATTGTTGGAGGAACTCTCCAGG
GCCTCAAGATCCACAACAGAGCCTTCTAGAAGACTGGTCAATAACTAGTTGGTCTTTGTCTGAGTCTGACTTACGAGGTT
GCATACTCGCTCCCTTTGCCTCGTCAATCGATGAGAAAAAGCGCCAAAACTCGCAATATGGCTTTGAACCACACGGTGCT
GAGACTAGTTAGAATCTAGTCCCAAACTAGCTTGGATAGCTTACCTTTGCCCTTTGCGTTGCGACAGGTCTTGCAGGGTA
TGGTTCCTTTCTCACCAGCTGATTTAGCTGCCTTGCTACCCTCACGGCGGATCTGCATAAAGAGTGGCTAGAGGTTATAA
ATTAGCACTGATCCTAGGTACGGGGCTGAATGTAACTTGCCYTTCCTTTCTCATCGCGCGGCAAGACAGGCTTGCTCAAA
TTCCTACCAGTCACAGGGGTATGCACGGCGTACGGACCACTTGAACTAGTCACAGATTAGTTAGCAACTAGTCTGCATTG
AATGGCTGTACTTACGGGCCCTCGCCATTGTCCTGATCATTTCCAGCTTCACCCTCGTTGCTGCAAAGTAGTTAGTGACT
AGTCAAGGACTAGTTGAAATGGGAGAAGAAACTCACGAATTCTCGACACCCTTAGTATTGTGGTCCTTGGACTTGGTGCT
GCTATATATTAGCTAATACACTAGTTAGACTCACAGAAACTTACGCAGCTCGCTTGCGCTTCTTGGTAGGAGTCGGGGTT
GGGAGAACAGTGCCTTCAAACAAGCCTTCATACCATGCTACTTGACTAGTCAGGGACTAGTCACCAAGTAATCTAGATAG
GACTTGCCTTTGGCCTCCATCAGTTCCTTCATAGTGGGAGGTCCATTGTGCAATGTAAACTCCATGCCGTGGGAGTTCTT
RTCCTTCAAGTGCTTGACCAATATGTTTCTGTTGGCAGAGGGAACCTGTCAACTAGTTAATAACTAGTCAGAAACTAGTA
TAGCAGTAGACTCACTGTACGCTTGAGGCATCCCTTCACTCGGCAGTAGACTTCATATGGATGGATATCAGGCACGCCAT
TGTCGTCCTGTGGACTAGTCAGTAACTAGGCTTAAAGCTAGTCGGGTCGGCTTACTATCTTGAAATCCGGCAGCGTAAGC
TCCCCGTCCTTAACTGCCTCGAGATAGTGACAGTACTCTGGGGACTTTCGGAGATCGTTATCGCGAATGCTCGGCATACT
AATCGTTGACTAGTCTTGGACTAGTCCCGAGCAAAAAGGATTGGAGGAGGAGGAGGAAGGTGAGAGTGAGACAAAGAGCG
AAATAAGAGCTTCAAAGGCTATCTCTAAGCAGTATGAAGGTTAAGTATCTAGTTCTTGACTAGATTTAAAAGAGATTTCG
ACTAGTTATGTACCTGGAGTTTGGATATAGGAATGTGTTGTGGTAACGAAATGTAAGGGGGAGGAAAGAAAAAGTCGGTC
AAGAGGTAACTCTAAGTCGGCCATTCCTTTTTGGGAGGCGCTAACCATAAACGGCATGGTCGACTTAGAGTTAGCTCAGG
GAATTTAGGGAGTTATCTGCGACCACCGAGGAACGGCGGAATGCCAAAGAATCCCGATGGAGCTCTAGCTGGCGGTTGAC
AACCCCACCTTTTGGCGTTTCTGCGGCGTTGCAGGCGGGACTGGATACTTCGTAGAACCAGAAAGGCAAGGCAGAACGCG
CTCAGCAAGAGTGTTGGAAGTGATAGCATGATGTGCCTTGTTAACTAGGTCAAAATCTGCAGTATGCTTGATGTTATCCA
AAGTGTGAGAGAGGAAGGTCCAAACATACACGATTGGGAGAGGGCCTAGGTATAAGAGTTTTTGAGTAGAACGCATGTGA
GCCCAGCCATCTCGAGGAGATTAAACACGGGCCGGCATTTGATGGCTATGTTAGTACCCCAATGGAAACGGTGAGAGTCC
AGTGGTCGCAGATAACTCCCTAAATTCCCTGAGCTAACTCTAAGTCGACCATGCCGTTTATGGTTAGCGCCTCCCAAAAA
GGAATGGCCGACTTAGAGTTACCTCTTGACCGACTTTTTCTTTCCTCCCCCTTACATTTCGTTACCACAACACATTCCTA
TATCCAAACTCCAGGTACATAACTAGTCGAAATCTCTTTTAAATCTAGTCAAGAACTAGATACTTAACCTTCATACTGCT
TAGAGATAGCCTTTGAAGCTCTTATTTCGCTCTTTGTCTCACTCTCACCTTCCTCCTCCTCCTCCAATCCTTTTTGCTCG
GGACTAGTCCAAGACTAGTCAACGATTAGTATGCCGAGCATTCGCGATAACGATCTCCGAAAGTCCCCAGAGTACTGTCA
CTATCTCGAGGCAGTTAAGGACGGGGAGCTTACGCTGCCGGATTTCAAGATAGTAAGCCGACCCGACTAGCTTTAAGCCT
AGTTACTGACTAGTCCACAGGACGACAATGGCGTGCCTGATATCCATCCATATGAAGTCTACTGCCGAGTGAAGGGATGC
CTCAAGCGTACAGTGAGTCTACTGCTATACTAGTTTCTGACTAGTTATTAACTAGTTGACAGGTTCCCTCTGCCAACAGA
AACATATTGGTCAAGCACTTGAAGGAYAAGAACTCCCACGGCATGGAGTTTACATTGCACAATGGACCTCCCACTATGAA
GGAACTGATGGAGGCCAAAGGCAAGTCCTATCTAGATTACTTGGTGACTAGTCCCTGACTAGTCAAGTAGCATGGTATGA
AGGCTTGTTTGAAGGCACTGTTCTCCCAACCCCGACTCCTACCAAGAAGCGCAAGCGAGCTGCGTAAGTTTCTGTGAGTC
TAACTAGTGTATTAGCTAATATATAGCAGCACCAAGTCCAAGGACCACAATACTAAGGGTGTCGAGAATTCGTGAGTTTC
TTCTCCCATTTCAACTAGTCCTTGACTAGTCACTAACTACTTTGCAGCAACGAGGGTGAAGCTGGAAATGATCAGGACAA
TGGCGAGGGCCCGTAAGTACAGCCATTCAATGCAGACTAGTTGCTAACTAATCTGTGACTAGTTCAAGTGGTCCGTACGC
CGTGCATACCCCTGTGACTGGTAGGAATTTGAGCAAGCCTGTCTTGCCGCGCGATGAGAAAGGAARGGCAAGTTACATTC
AGCCCCGTACCTAGGATCAGTGCTAATTTATAACCTCTAGCCACTCTTTATGCAGATCCGCCGTGAGGGTAGCAAGGCAG
CTAAATCAGCTGGTGAGAAAGGAACCATACCCTGCAAGACCTGTCGCAACGCAAAGGGCAAAGGTAAGCTATCCAAGCTA
GTTTGGGACTAGATTCTAACTAGTCTCAGCACCGTGTGGTTCAAAGCCATATTGCGAGTTTTGGCGCTTTTTCTCATCGA
TTGACGAGGCAAAGGGAGCGAGTATGCAACCTCGTAAGTCAGACTCAGACAAAGACCAACTAGTTATTGACCAGTCTTCT
AGAAGGCTCTGTTGTGGATCTTGAGGCCCTGGAGAGTTCCTCCAACAATCCGGAGACAAGCAAGTCCTCGTCGGACTAGT
CACTAACTAGACTCTAACTAGTTGCAGACATGGATAATGCAAAAGAGACAAGCAATGAAGAAAGTGGTAAGACATTTCTC
CTTTGTGGTTCTGGACTAGTCTTTGACTAGTCACAGTCTTAAACAAGGAAAATGAGCATGAAAATGAGGAGGAAAAGGCT
GCTGAGCCCGAGGAAGTGCAGGGTGATGGCAGACATGGTAGGTTAATACCTTGTTAGTTATTGCTAGTCACTGACTAGTC
AATAACTAGTCTCTGAACACCTTGCAATCACTCCGTTTGCGCAGCTGAACAGTGGTGAGGATAATAGTAGTAAGTTATTC
TAGCTTCAGAGTTATAGGAGACTAGATACTAACTAGTATTAGTTGCAACTAACCTGGATCTCAGAGACTTTGGCCTCAAT
CTAGAATCTATCTAGTTGTCAACTAGACTGTGGTATCATTGTCTTTTATTTTCCTAGTCCTGGAACTAGCTTCTAACTAG
TCTCCCTAATATGTGGCTGTCTTGTTTTTTTTTTTTGTTTCCCTACCCGGATATCTAGTCCCCTTCTAGGTTCTGTTAAC
CTCTCGGGCTCTGATTTAGTTTAACGCAAACCTGAGATTAGTTTCTAACTAGTCTCTAGGTTTTCTATCCACCTTTAATT
GTAATAATAAATACAAGCAACGTTTATACGTCAAAAGCATTTATAAACTTTTACCCTAAAGTAGCTTGCTTGTGTGTTTA
GTTTATAATTAGTCTCTTATTAATTTGATGTAGGTAAGCCCGCCACAAATATATATTTTTAACAAGATACCGTGGAAAAA
CTTCGTGCTATCACAAAACAGTATACAAAAAATAAGCTTAACAATCTATTCTCCGCTTGGTGATGCTAAAGGGCTTTCAA
TAGACCTTGTAAGTGAAGGAGATGGAGCCGTCAATCCGCTACCCTGCCTCTGGTCAGTTGGTCTCAGCAATGTACCCTGT
GAGTCTTGATAGACTAGTTGGTGACTAGTCTCTGTAGATGGAACAAATGGTGCTTGAGAGGGCACGTATGGCAGAGCTCC
AGTCATCTGCGGAACATATACTGGGCCCGGGAAGATCTCATGGTCATAGCTGTTTCCGCTGAGGGTTTAATTAAGACCTC
AGCCGAGACAGCAGAATCACCGCCCAAGTTAAGCCTTTGTGCTGATCATGCTCTCGAACGGGCCAAGTTCGGGAAAAGCA
AAGGAGCGTTTAGTGAGGGGCAATTTGACTCACCTCCCAGGCAACAGATGAGGGGGGCAAAAAGAAAGAAATTTTCGTGA
GTCAATATGGATTCCGAGCATCATTTTCTTGCGGTCTATCTTGCTACGTATGTTGATCTTGACGCTGTGGATCAAGCAAC
GCCACTCGCTCGCTCCATCGCAGGCTGGTCGCAGACAAATTAAAAGGCGGCAAACTCGTACAGCCGCGGGGTTGTCCGCT
GCAAAGTACAGAGTGATAAAAGCCGCCATGCGACCATCAACGCGTTGATGCCCAGCTTTTTCGATCCGAGAATCCACCGT
AGAGGCGATAGCAAGTAAAGAAAAGCTAAACAAAAAAAAATTTCTGCCCCTAAGCCATGAAAACGAGATGGGGTGGAGCA
GAACCAAGGAAAGAGTCGCGCTGGGCTGCCGTTCCGGAAGGTGTTGTAAAGGCTCGACGCCCAAGGTGGGAGTCTAGGAG
AAGAATTTGCATCGGGAGTGGGGCGGGTTACCCCTCCATATCCAATGACAGATATCTACCAGCCAAGGGTTTGAGCCCGC
CCGCTTAGTCGTCGTCCTCGCTTGCCCCTCCATAAAAGGATTTCCCCTCCCCCTCCCACAAAATTTTCTTTCCCTTCCTC
TCCTTGTCCGCTTCAGTACGTATATCTTCCCTTCCCTCGCTTCTCTCCTCCATCCTTCTTTCATCCATCTCCTGCTAACT
TCTCTGCTCAGCACCTCTACGCATTACTAGCCGTAGTATCTGAGCACTTCTCCCTTTTATATTCCACAAAACATAACACA
ACCTTCACCATGGACAAGAAGTATAGCATCGGGCTGGACATTGGAACGAACTCGGTTGGTTGGGCTGTGATTACGGACGA
ATACAAGGTGCCATCCAAGAAGTTTAAGGTCCTGGGAAACACCGACCGTCACTCAATCAAGAAGAATCTCATTGGAGCCC
TGCTCTTCGATAGTGGGGAGACCGCCGAAGCTACTCGACTGAAGCGAACGGCTCGCCGGCGTTATACACGACGCAAGAAT
CGCATCTGCTACCTCCAGGAGATTTTCAGCAACGAAATGGCTAAGGTTGATGACTCATTCTTTCATCGACTCGAAGAAAG
TTTCTTGGTCGAGGAGGATAAGAAGCACGAGCGCCATCCGATCTTTGGTAACATTGTGGATGAGGTTGCCTATCACGAAA
AGTACCCAACTATCTATCATCTTCGTAAGAAGCTGGTCGATAGCACGGACAAGGCTGATTTGCGACTTATCTACCTGGCA
CTCGCGCACATGATTAAGTTCCGCGGCCATTTTCTTATCGAGGGTGACCTGAACCCCGATAATTCTGACGTTGATAAGCT
CTTCATCCAGTTGGTCCAAACCTACAATCAGCTGTTTGAGGAAAACCCTATTAATGCATCTGGCGTGGACGCCAAGGCTA
TCCTTTCGGCGCGCCTGTCTAAGTCGCGGCGTTTGGAGAACCTTATCGCACAACTCCCCGGCGAAAAGAAGAACGGCCTC
TTCGGTAATTTGATTGCGTTGTCACTTGGTCTGACTCCTAACTTCAAGAGTAATTTTGACCTGGCAGAGGATGCGAAGCT
CCAGTTGTCTAAGGATACGTATGATGACGATCTCGACAACTTGCTTGCCCAAATCGGTGACCAGTACGCTGATCTTTTCC
TGGCCGCTAAGAATCTCTCAGATGCAATCCTGCTCAGTGACATTTTGCGGGTCAACACCGAGATTACTAAGGCCCCCCTG
TCAGCTAGTATGATCAAGCGGTATGATGAGCACCATCAGGACCTCACCTTGCTTAAGGCCCTCGTGCGTCAGCAATTGCC
TGAGAAGTATAAGGAAATCTTCTTTGACCAATCCAAGAACGGATACGCAGGGTATATTGATGGCGGTGCGAGCCAGGAGG
AATTCTACAAGTTTATCAAGCCGATTTTGGAGAAGATGGACGGCACTGAGGAACTGCTCGTCAAGCTGAATCGCGAAGAT
TTGCTTCGTAAGCAACGAACGTTCGACAACGGCTCCATCCCGCACCAGATTCATCTGGGCGAGCTCCACGCCATCCTTCG
ACGCCAGGAAGATTTCTACCCATTTCTGAAGGACAACCGTGAGAAGATCGAAAAGATTCTTACATTCCGAATCCCCTACT
ATGTGGGACCTTTGGCCCGTGGGAATTCCCGATTTGCTTGGATGACCCGAAAGAGCGAGGAAACCATCACTCCGTGGAAC
TTCGAGGAAGTCGTGGACAAGGGTGCATCCGCGCAGAGCTTCATTGAGCGGATGACCAATTTTGATAAGAACCTTCCGAA
TGAAAAGGTCCTGCCAAAGCATTCGCTGCTCTACGAGTATTTCACCGTGTATAACGAACTGACTAAGGTCAAGTACGTGA
CGGAGGGAATGCGGAAGCCAGCCTTCCTCTCAGGGGAACAAAAGAAGGCTATCGTCGATTTGCTTTTTAAGACCAATCGT
AAAGTGACTGTTAAGCAGCTGAAGGAGGATTATTTCAAGAAGATTGAATGTTTCGACTCCGTCGAGATCAGCGGCGTGGA
AGATCGCTTTAACGCTTCCCTCGGTACCTACCACGACCTGCTCAAGATCATTAAGGACAAGGATTTCCTCGATAACGAGG
AAAATGAGGACATCTTGGAAGATATTGTCCTCACGTTGACACTTTTTGAGGACCGCGAAATGATCGAGGAACGGCTCAAG
ACATATGCCCATTTGTTCGACGATAAGGTGATGAAGCAGCTGAAGCGGCGTCGATACACCGGATGGGGTCGCCTTAGCCG
GAAGCTGATCAACGGCATTCGAGATAAGCAATCTGGTAAGACTATCTTGGATTTCCTTAAGTCGGACGGCTTCGCCAACC
GCAATTTTATGCAGCTTATTCACGACGATTCCCTGACGTTCAAGGAGGACATCCAGAAGGCACAAGTCTCAGGACAAGGG
GATTCCCTGCACGAGCATATCGCCAACCTGGCTGGATCCCCGGCGATCAAGAAGGGGATTCTTCAGACCGTCAAGGTTGT
CGACGAGCTGGTCAAGGTGATGGGCCGTCATAAGCCAGAAAACATCGTGATTGAGATGGCCCGAGAAAATCAGACCACTC
AAAAGGGTCAGAAGAACAGCCGCGAGCGGATGAAGCGGATCGAGGAAGGCATTAAGGAACTTGGTTCTCAGATCCTGAAG
GAGCACCCTGTTGAAAACACACAGCTCCAAAATGAGAAGCTGTATCTCTACTATTTGCAAAATGGACGCGACATGTACGT
CGATCAGGAGCTCGACATTAACCGGTTGTCGGACTACGATGTTGACCATATCGTCCCGCAATCCTTCCTTAAGGACGATA
GCATTGATAACAAGGTGCTGACTCGCTCAGATAAGAACCGGGGCAAGTCCGACAATGTTCCAAGCGAGGAAGTGGTTAAG
AAGATGAAGAACTACTGGCGCCAATTGCTTAATGCCAAGCTCATCACACAGCGCAAGTTTGACAACTTGACCAAGGCCGA
GCGGGGAGGGCTGAGTGAACTCGATAAGGCTGGCTTCATCAAGCGTCAACTCGTGGAGACGCGACAGATCACAAAGCACG
TTGCTCAGATTCTGGACTCCCGGATGAACACAAAGTACGACGAGAATGATAAGCTCATCCGTGAAGTTAAGGTCATTACC
CTCAAGTCTAAGTTGGTGTCGGATTTCCGCAAGGACTTCCAATTTTATAAGGTTCGGGAGATCAACAATTATCACCATGC
ACATGATGCGTACCTCAACGCAGTCGTGGGAACTGCGCTCATCAAGAAGTATCCCAAGTTGGAGTCCGAATTCGTCTACG
GGGATTATAAGGTTTACGACGTCCGCAAGATGATCGCCAAGAGTGAGCAGGAAATTGGCAAGGCCACGGCTAAGTATTTC
TTTTACTCCAACATCATGAATTTCTTTAAGACGGAGATCACACTCGCCAATGGAGAAATCCGTAAGCGACCTTTGATTGA
GACCAACGGCGAGACTGGTGAAATCGTTTGGGATAAGGGGCGCGACTTCGCTACCGTGCGGAAGGTTCTGAGCATGCCGC
AAGTCAATATCGTCAAGAAAACCGAGGTGCAGACAGGCGGTTTCTCTAAGGAATCGATTCTTCCAAAGCGTAACTCTGAC
AAGCTGATCGCTCGAAAGAAGGATTGGGACCCCAAGAAGTATGGAGGGTTCGATTCTCCTACAGTGGCATACTCGGTTCT
CGTTGTCGCGAAGGTTGAGAAGGGAAAGTCTAAGAAGCTGAAGTCGGTCAAGGAACTGCTCGGGATCACCATTATGGAGC
GCTCCAGCTTCGAAAAGAATCCCATCGACTTTCTCGAGGCCAAGGGCTATAAGGAAGTCAAGAAGGATCTTATCATTAAG
CTGCCTAAGTACTCTTTGTTCGAGCTTGAAAACGGTCGAAAGCGAATGCTCGCATCGGCAGGAGAGTTGCAGAAGGGGAA
TGAATTGGCACTTCCCTCAAAGTACGTGAACTTCCTGTATCTCGCGTCCCACTACGAGAAGCTGAAGGGTAGCCCTGAGG
ACAACGAACAGAAGCAACTTTTTGTTGAGCAACACAAGCATTATCTGGATGAGATCATTGAACAGATTTCAGAGTTCAGT
AAGCGCGTCATCCTCGCCGATGCTAATCTCGACAAGGTGTTGTCGGCCTACAACAAGCACCGTGACAAGCCGATCCGAGA
GCAGGCTGAAAATATCATTCATCTGTTCACCCTCACTAACTTGGGAGCACCAGCAGCGTTCAAGTATTTTGATACGACAA
TCGACCGTAAGCGATACACGTCCACAAAGGAGGTGCTTGATGCGACCCTGATTCATCAATCCATCACTGGGCTCTATGAA
ACCCGTATCGACCTTAGTCAACTGGGGGGCGACCCTCCCAAGAAGAAGCGCAAGGTCTGAGCGGACATTCGATTTATGCC
GTTATGACTTCCTTAAAAAAGCCTTTACGAATGAAAGAAATGGAATTAGACTTGTTATGTAGTTGATTCTACAATGGATT
ATGATTCCTGAACTTCAAATCCGCTGTTCATTATTAATCTCAGCTCTTCCCGTAAAGCCAATGTTGAAACTATTCGTAAA
TGTACCTCGTTTTGCGTGTACCTTGCTTATCACGTGATATTACATGACCTGGACAGAGTTCTGCGCGAAAGTCATAACGT
AAATCCCGGGCGGTAGGTGCGTCCCGGGCGGAAGGTAGTTTTCTCGTCCACCCCAACGCGTTTATCAACCTCAACTTTCA
ACAACCATCATGCCACCAAAAGCGCGTAAAACAAAGCGAGATTTGATTGAGCAAGAGGGCAGGATCCAATGCGCGATTCA
AGACATTAAAAATGGAAAATTTCAAAAAATTGCGCCCGCAGCGCGTGCATACAAAATTCATCCCAATACAAGTGTAATGC
TAGTGGAGGTCAACACATCAATGCCTATTTTGGTTTAGTCGTCCAGGCGGTGAGCACAAAATTTGTGTCGTTTGACAAGA
TGGTTCATTTAGGCAACTGGTCAGATCAGCCCCACTTGTAGCAGTAGCGGCGGCGCTCGAAGTGTGACTCTTATTAGCAG
ACAGGAACGAGGACATTATTATCATCTGCTGCTTGGTGCACGATAACTTGGTGCGTTTGTCAAGCAAGGTAAGTGGACGA
CCCGGTCATACCTTCTTAAGTTCGCCCTTCCTCCCTTTATTTCAGATTCAATCTGACTTACCTATTCTACCCAAGCATCC
AAATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATG
CAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTG
CGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGACA
TTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACC
GAACTGCCCGCTGTTCTCCAGCCGGTCGCGGAGGCCATGGATGCGATTGCTGCGGCCGATCTTAGCCAGACGAGCGGGTT
CGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGT
ATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAG
GACTGCCCCGAAGTCCGGCACCTCGTGCATGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGC
GGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCCTCTTCTGGAGGCCGTGGTTGG
CTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGCCTCCGGGCGTATATG
CTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATG
CGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATG
GCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAGAGTAGATGCCGA
CCGATCCCCACTACCGCATTAAGACCTCAGCGCGGCCGCAAATTTAAATAAAATGAAGTGAAGTTCCTATACTTTCTAGA
GAATAGGAACTTCTATAGTGAGTCGAATAAGGGCGACACAAAATTTATTCTAAATGCATAATAAATACTGATAACATCTT
ATAGTTTGTATTATATTTTGTATTATCGTTGACATGTATAATTTTGATATCAAAAACTGATTTTCCCTTTATTATTTTCG
AGATTTATTTTCTTAATTCTCTTTAACAAACTAGAAATATTGTATATACAAAAAATCATAAATAATAGATGAATAGTTTA
ATTATAGGTGTTCATCAATCGAAAAAGCAACGTATCTTATTTAAAGTGCGTTGCTTTTTTCTCATTTATAAGGTTAAATA
ATTCTCATATATCAAGCAAAGTGACAGGCGCCCTTAAATATTCTGACAAATGCTCTTTCCCTAAACTCCCCCCATAAAAA
AACCCGCCGAAGCGGGTTTTTACGTTATTTGCGGATTAACGATTACTCGTTATCAGAACCGCCCAGGGGGCCCGAGCTTA
AGACTGGCCGTCGTTTTACAACACAGAAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGGGCCTTCTGCTTAGTT
TGATGCCTGGCAGTTCCCTACTCTCGCCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGA
GCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAA
AGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATC
ACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC
CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTC
TCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTC
AGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCA
GCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGGCTAACTACGGCTA
CACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCG
GCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAA
GATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGACGCGCGCGTAACTCACGTTAAGGGATTTTGGTCATG
AGCTTGCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCTT
//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart