pFCcGi

$260.00

  • Model: PVT14503
  • 20 Units in Stock
Ask a question


Add to Cart:

pFCcGi

PVT14503    2ug
 

 

pFCcGi Search name

pFCcGi,pFCcGi vector,pFCcGi plasmid,pFCcGi map

 

 

pFCcGi Information

Bacterial Resistance(s):   Amp

Screening: EGFP/mCherry 
Growth Strain(s): DH5 alpha
Growth Condition: LB/37 Centigrade

 

pFCcGi Sequence

GCAAGACCCGTTCTAAAGCCATCCTGGCTGCAGCGGGTATCGCTGAAAATGTTAAGATCCTGGGAGGAGATATACATATG
GTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAA
CGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCA
AGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCC
GCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGG
CGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCC
CCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCC
CTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGC
CAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCA
TCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGCGGCCGCGAAAG
CTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGT
CATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATCGAT
GCATAATGTGCCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCAATTGTCTGATT
CGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCACAACCGGCACGGAACTCGCTCGGGCTGGCCC
CGGTGCATTTTTTAAATACCCGCGAGAAATAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATC
CGGGTGGTGCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAATCCCTAACTGCTG
GCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTGTGCGACGCTGGCGATATCAAAATTGCTGTCTGCCA
GGTGATCGCTGATGTACTGACAAGCCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATG
CGCCGCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTTGCCCGGCGTTAATGAT
TTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCCGGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCC
AGTTAAGCCATTCATGCCAGTAGGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGA
CCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAATTCTCGTCCCTGATTTTTCAC
CACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACCTTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAAC
CGTTGGCCTCAATCGGCGTTAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCGCT
TCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCATCAGACATTGCCGTCACTGCGT
CTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCCGCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCA
TGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGC
TATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATA
CCCGTTTTTTTGGGCTAGCAGGAGGAATTCACCATGGTACCCGGGGATCCTCTAGATTTAAGAAGGAGATATACATATGA
GTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCT
GTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGT
TCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATG
ACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACA
CGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAA
CATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCA
AAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATT
GGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAG
AGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAAATGTCCA
GACCTGCAGGCATGCAAGCTATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTTTTAGCCGCT
TTAGCGGCCTTTCCCCCTACCCGAAGGGTGGGGGCGCGTGTGCAGCCCCGCAGGGCCTGTCTCGGTCGATCATTCAGCCC
GGCTCATCCTTCTGGCGTGGCGGCAGACCGAACAAGGCGCGGTCGTGGTCGCGTTCAAGGTACGCATCCATTGCCGCCAT
GAGCCGATCCTCCGGCCACTCGCTGCTGTTCACCTTGGCCAAAATCATGGCCCCCACCAGCACCTTGCGCCTTGTTTCGT
TCTTGCGCTCTTGCTGCTGTTCCCTTGCCCGCACCCGCTGAATTTCGGCATTGATTCGCGCTCGTTGTTCTTCGAGCTTG
GCCAGCCGATCCGCCGCCTTGTTGCTCCCCTTAACCATCTTGACACCCCATTGTTAATGTGCTGTCTCGTAGGCTATCAT
GGAGGCACAGCGGCGGCAATCCCGACCCTACTTTGTAGGGGAGGGCGCACTTACCGGTTTCTCTTCGAGAAACTGGCCTA
ACGGCCACCCTTCGGGCGGTGCGCTCTCCGAGGGCCATTGCATGGAGCCGAAAAGCAAAAGCAACAGCGAGGCAGCATGG
CGATTTATCACCTTACGGCGAAAACCGGCAGCAGGTCGGGCGGCCAATCGGCCAGGGCCAAGGCCGACTACATCCAGCGC
GAAGGCAAGTATGCCCGCGACATGGATGAAGTCTTGCACGCCGAATCCGGGCACATGCCGGAGTTCGTCGAGCGGCCCGC
CGACTACTGGGATGCTGCCGACCTGTATGAACGCGCCAATGGGCGGCTGTTCAAGGAGGTCGAATTTGCCCTGCCGGTCG
AGCTGACCCTCGACCAGCAGAAGGCGCTGGCGTCCGAGTTCGCCCAGCACCTGACCGGTGCCGAGCGCCTGCCGTATACG
CTGGCCATCCATGCCGGTGGCGGCGAGAACCCGCACTGCCACCTGATGATCTCCGAGCGGATCAATGACGGCATCGAGCG
GCCCGCCGCTCAGTGGTTCAAGCGGTACAACGGCAAGACCCCGGAGAAGGGCGGGGCACAGAAGACCGAAGCGCTCAAGC
CCAAGGCATGGCTTGAGCAGACCCGCGAGGCATGGGCCGACCATGCCAACCGGGCATTAGAGCGGGCTGGCCACGACGCC
CGCATTGACCACAGAACACTTGAGGCGCAGGGCATCGAGCGCCTGCCCGGTGTTCACCTGGGGCCGAACGTGGTGGAGAT
GGAAGGCCGGGGCATCCGCACCGACCGGGCAGACGTGGCCCTGAACATCGACACCGCCAACGCCCAGATCATCGACTTAC
AGGAATACCGGGAGGCAATAGACCATGAACGCAATCGACAGAGTGAAGAAATCCAGAGGCATCAACGAGTTAGCGGAGCA
GATCGAACCGCTGGCCCAGAGCATGGCGACACTGGCCGACGAAGCCCGGCAGGTCATGAGCCAGACCCAGCAGGCCAGCG
AGGCGCAGGCGGCGGAGTGGCTGAAAGCCCAGCGCCAGACAGGGGCGGCATGGGTGGAGCTGGCCAAAGAGTTGCGGGAG
GTAGCCGCCGAGGTGAGCAGCGCCGCGCAGAGCGCCCGGAGCGCGTCGCGGGGGTGGCACTGGAAGCTATGGCTAACCGT
GATGCTGGCTTCCATGATGCCTACGGTGGTGCTGCTGATCGCATCGTTGCTCTTGCTCGACCTGACGCCACTGACAACCG
AGGACGGCTCGATCTGGCTGCGCTTGGTGGCCCGATGAAGAACGACaggactttgcaggccataggccgacagctcaagg
ccatgggctgtgagcgctCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCA
GCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCA
AAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATC
GACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGC
TCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTC
ACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACC
GCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGT
AACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAG
GACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAA
CCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTG
ATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGAT
CTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTT
ACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTG
TAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCC
AGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGT
CTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGC
ATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCC
CATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCA
TGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACC
AAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAG
CAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCA
GTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACA
GGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTA
TTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTC
CGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGT
ATCACGAGGCCCTTTCGTCTTCAAGAATTCGAGCTCGGTACCCGGGGATCCCGGAGTTCATGCGTGATGCAATGAAAGTG
CCGTTCTACTTCGGTGGGACCTCACTGCTTATCGTTGTTGTCGTGATTATGGACTTTATGGCTCAAGTGCAAACTCTGAT
GATGTCCAGTCAGTATGAGTCTGCATTGAAGAAGGCGAACCTGAAAGGCTACGGCCGTTAATTGGTCGCCTGAGAAGTTA
CGGAGAGTAAAAATGAAAGTTCGTGCTTCCGTCAAGAAATTATGCCGTAACTGCAAAATCGTTAAGCGTGATGGTGTCAT
CCGTGTGATTTGCAGTGCCGAGCCGAAGCATAAACAGCGCCAAGGCTGATTTTTTCGCATATTTTTCTTGCAAAGTTGGG
TTGAGCTGGCTAGATTAGCCAGCCAATCTTTTGTATGTCTGTACGTTTCCATTTGAGTATCCTGAAAACGGGCTTTTCAG
CATGGTACGTACATATTAAATAGTAGGAGTGCATAGTGGCCCGTATAGCAGGCATTAACATTCCTGATCAGAAACACGCC
GTGATCGCGTTAACTTCGATCTACGGTGTCG

//

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart