

  • Model: PVT11220
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11220
Packing 2ug


pFGC5941 Multiple cloning site




pFGC5941 Information

Promoter: CaMV 35S

Replicon: pVS1 oriV, ori

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 11406bp

Prokaryotic resistance: Kan

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

Primers for 3'sequencing: primers designed based on sequences


pFGC5941 Sequence

LOCUS       Exported               11406 bp ds-DNA     circular SYN 11-JAN-2016
DEFINITION  Agrobacterium binary vector for expressing dsRNA, with two multiple 
            cloning sites separated by an intron.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 11406)
  AUTHORS   Kerschen A, Napoli CA, Jorgensen RA, Muller AE.
  TITLE     Effectiveness of RNA interference in transgenic plants.
  JOURNAL   FEBS Lett. 2004;566:223-8.
  PUBMED    15147899
REFERENCE   2  (bases 1 to 11406)
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1
COMMENT     The GenBank sequence was corrected by inserting a G at position 
FEATURES             Location/Qualifiers
     source          1..11406
                     /organism="synthetic DNA construct"
                     /lab_host="Plant Cells"
                     /mol_type="other DNA"
     misc_feature    1..25
                     /note="LB T-DNA repeat"
                     /note="left border repeat from nopaline C58 T-DNA"
     terminator      111..363
                     /note="MAS terminator"
                     /note="mannopine synthase terminator"
     CDS             complement(373..924)
                     /gene="Streptomyces hygroscopicus bar"
                     /product="phosphinothricin acetyltransferase"
                     /note="confers resistance to bialophos or phosphinothricin"
     promoter        complement(930..1310)
                     /note="MAS promoter"
                     /note="mannopine synthase promoter (Velten et al., 1984)"
     promoter        2305..2650
                     /note="CaMV 35S promoter"
                     /note="strong constitutive promoter from cauliflower mosaic
     misc_feature    2680..2734
                     /note="TMV Omega"
                     /note="translational enhancer from the tobacco mosaic virus
                     5'-leader sequence (Gallie et al., 1988)"
     misc_feature    2734..2764
                     /note="MCS 1"
                     /note="multiple cloning site 1"
     intron          2767..4115
                     /note="chsA intron"
                     /note="chalcone synthase A intron from Petunia hybrida"
     misc_feature    4122..4160
                     /note="MCS 2"
                     /note="multiple cloning site"
     terminator      4177..4884
                     /note="OCS terminator"
                     /note="octopine synthase terminator"
     misc_feature    5128..5152
                     /note="RB T-DNA repeat"
                     /note="right border repeat from nopaline C58 T-DNA"
     CDS             6452..7081
                     /product="stability protein from Pseudomonas plasmid pVS1"
                     /note="pVS1 StaA"
     CDS             7510..8583
                     /product="replication protein from Pseudomonas plasmid 
                     /note="pVS1 RepA"
     rep_origin      8649..8843
                     /note="pVS1 oriV"
                     /note="origin of replication for the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
     misc_feature    9187..9327
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(9513..10101)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(10188..10982)
                     /product="aminoglycoside phosphotransferase"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
