
  • Model: PVT1022
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1022        2ug


pFLAG-CMV2 Information

Promoter: CMV

Replicator: pBR322 ori, F1 ori, SV40 ori

Terminator: HGH poly (A) signal

Plasmid classification: mammalian cell carrier; protein overexpression plasmid.

Plasmid size: 4679bp

Plasmid tagging: N-Flag

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: lactation cells

Culture conditions: 37 C, aerobic, LB

5'sequencing primers: CMV-F: CGCAAATGGGCGGTAGGCGTG

3'sequencing primers: hGH-pA-R: CCAGCTTGGTTCCCAATAGA


pFLAG-CMV2 Description

pFLAG-CMV2 is a mammalian cell plasmid with ampicillin resistance. Its size is 4679bp.

pFLAG-CMV2 Multiple cloning site




pFLAG-CMV2 Sequence

LOCUS       Exported                4679 bp ds-DNA    circular SYN 04-11-2015
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4679)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-11-4  
FEATURES             Location/Qualifiers
     source          1..4679
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     primer_bind     141..157
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
     enhancer        318..697
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        698..901
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     CDS             935..958
                     /product="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     polyA_signal    1020..1642
                     /note="hGH poly(A) signal"
                     /note="human growth hormone polyadenylation signal"
     promoter        1671..2000
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      1851..1986
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(2039..2057)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(2071..2087)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    2095..2111
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2119..2149)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    2164..2185
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(2473..3061)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3232..4092)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4093..4197)
                     /note="AmpR promoter"
     rep_origin      4224..4679
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct
       61 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg
      121 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa
      181 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta
      241 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc
      301 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg
      361 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc
      421 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat
      481 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc
      541 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga
      601 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg
      661 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac
      721 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt
      781 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc
      841 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc
      901 tcgtttagtg aaccgtcaga attgatctac catggactac aaagacgatg acgacaagct
      961 tgcggccgcg aattcatcga tagatctgat atcggtacca gtcgactcta gaggatcccg
     1021 ggtggcatcc ctgtgacccc tccccagtgc ctctcctggc cctggaagtt gccactccag
     1081 tgcccaccag ccttgtccta ataaaattaa gttgcatcat tttgtctgac taggtgtcct
     1141 tctataatat tatggggtgg aggggggtgg tatggagcaa ggggcaagtt gggaagacaa
     1201 cctgtagggc ctgcggggtc tattgggaac caagctggag tgcagtggca caatcttggc
     1261 tcactgcaat ctccgcctcc tgggttcaag cgattctcct gcctcagcct cccgagttgt
     1321 tgggattcca ggcatgcatg accaggctca gctaattttt gtttttttgg tagagacggg
     1381 gtttcaccat attggccagg ctggtctcca actcctaatc tcaggtgatc tacccacctt
     1441 ggcctcccaa attgctggga ttacaggcgt gaaccactgc tcccttccct gtccttctga
     1501 ttttaaaata actataccag caggaggacg tccagacaca gcataggcta cctggccatg
     1561 cccaaccggt gggacatttg agttgcttgc ttggcactgt cctctcatgc gttgggtcca
     1621 ctcagtagat gcctgttgaa ttgggtacgc ggccagcttg gctgtggaat gtgtgtcagt
     1681 tagggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc atgcatctca
     1741 attagtcagc aaccaggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa
     1801 gcatgcatct caattagtca gcaaccatag tcccgcccct aactccgccc atcccgcccc
     1861 taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg
     1921 cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg
     1981 gaggcctagg cttttgcaaa aagctcctcg aggaactgaa aaaccagaaa gttaattccc
     2041 tatagtgagt cgtattaaat tcgtaatcat gtcatagctg tttcctgtgt gaaattgtta
     2101 tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc
     2161 ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg
     2221 aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg
     2281 tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg
     2341 gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa
     2401 cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc
     2461 gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc
     2521 aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag
     2581 ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct
     2641 cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta
     2701 ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc
     2761 cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc
     2821 agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt
     2881 gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct
     2941 gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc
     3001 tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca
     3061 agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta
     3121 agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa
     3181 atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg
     3241 cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg
     3301 actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc ccagtgctgc
     3361 aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa accagccagc
     3421 cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc agtctattaa
     3481 ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca acgttgttgc
     3541 cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat tcagctccgg
     3601 ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag cggttagctc
     3661 cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac tcatggttat
     3721 ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt ctgtgactgg
     3781 tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc
     3841 ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg
     3901 aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat ccagttcgat
     3961 gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca gcgtttctgg
     4021 gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga cacggaaatg
     4081 ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg gttattgtct
     4141 catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg ttccgcgcac
     4201 atttccccga aaagtgccac ctgacgcgcc ctgtagcggc gcattaagcg cggcgggtgt
     4261 ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc
     4321 tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg
     4381 gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta
     4441 gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt
     4501 ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat
     4561 ctcggtctat tcttttgatt tataagggat tttgccgatt tcggcctatt ggttaaaaaa
     4621 tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgc ttacaattt


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
