pFLAG- CMV2 Plasmid


  • Model: PVT1022
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pFLAG-CMV2,Plasmid pFLAG-CMV2,pFLAG-CMV2 vector


pFLAG-CMV2 Information

Promoter: CMV

Replicator: pBR322 ori, F1 ori, SV40 ori

Terminator: HGH poly (A) signal

Plasmid classification: mammalian cell carrier; protein overexpression plasmid.

Plasmid size: 4679bp

Plasmid tagging: N-Flag

Prokaryotic resistance: ampicillin Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: lactation cells

Culture conditions: 37 C, aerobic, LB

5'sequencing primers: CMV-F: CGCAAATGGGCGGTAGGCGTG

3'sequencing primers: hGH-pA-R: CCAGCTTGGTTCCCAATAGA



pFLAG-CMV2 Multiple cloning site




pFLAG-CMV2 Sequence

LOCUS       Exported                4679 bp ds-DNA    circular SYN 04-11-2015
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4679)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-11-4   
FEATURES             Location/Qualifiers
     source          1..4679
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     primer_bind     141..157
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
     enhancer        318..697
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        698..901
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     CDS             935..958
                     /product="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     polyA_signal    1020..1642
                     /note="hGH poly(A) signal"
                     /note="human growth hormone polyadenylation signal"
     promoter        1671..2000
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      1851..1986
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(2039..2057)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(2071..2087)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    2095..2111
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(2119..2149)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    2164..2185
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(2473..3061)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3232..4092)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4093..4197)
                     /note="AmpR promoter"
     rep_origin      4224..4679
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
        1 ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg cctcttcgct
       61 attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg taacgccagg
      121 gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctgatct atacattgaa
      181 tcaatattgg caattagcca tattagtcat tggttatata gcataaatca atattggcta
      241 ttggccattg catacgttgt atctatatca taatatgtac atttatattg gctcatgtcc
      301 aatatgaccg ccatgttgac attgattatt gactagttat taatagtaat caattacggg
      361 gtcattagtt catagcccat atatggagtt ccgcgttaca taacttacgg taaatggccc
      421 gcctggctga ccgcccaacg acccccgccc attgacgtca ataatgacgt atgttcccat
      481 agtaacgcca atagggactt tccattgacg tcaatgggtg gagtatttac ggtaaactgc
      541 ccacttggca gtacatcaag tgtatcatat gccaagtccg ccccctattg acgtcaatga
      601 cggtaaatgg cccgcctggc attatgccca gtacatgacc ttacgggact ttcctacttg
      661 gcagtacatc tacgtattag tcatcgctat taccatggtg atgcggtttt ggcagtacac
      721 caatgggcgt ggatagcggt ttgactcacg gggatttcca agtctccacc ccattgacgt
      781 caatgggagt ttgttttggc accaaaatca acgggacttt ccaaaatgtc gtaataaccc
      841 cgccccgttg acgcaaatgg gcggtaggcg tgtacggtgg gaggtctata taagcagagc
      901 tcgtttagtg aaccgtcaga attgatctac catggactac aaagacgatg acgacaagct
      961 tg

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
