pFW5

$260.00

  • Model: PVT11374
  • 50 Units in Stock
Ask a question


Add to Cart:

pFW5


Catalog No. PVT11374
Packing 2ug

 

pFW5 Information

Replicator: pij101pbr322rp4t

Plasmid classification: gene editing vector; Streptococcus suicidal plasmid

Prokaryotic resistance: spe

Clone strain: DH5a

Culture condition: 37℃

Plasmid host: broad host

Prokaryotic resistance: spe

 

pFW5 Sequence

tgtacaattgctagcgtacggccgtcgacgtccggatcctcgagctctagatcttaagcttgattttcgttcgtgaatac
atgttataataactataactaataacgtaacgtgactggcaagagatatttttaaaacaatgaataggtttacacttact
ttagttttatggaaatgaaagatcatatcatatataatctagaataaaattaactaaaataattattatctagataaaaa
atttagaagccaatgaaatctataaataaactaaattaagtttatttaattaacaactatggatataaaataggtactaa
tcaaaatagtgaggaggatatatttgaatacatacgaacaaattaataaagtgaaaaaaatacttcggaaacatttaaaa
aataaccttattggtacttacatgtttggatcaggagttgagagtggactaaaaccaaatagtgatcttgactttttagt
cgtcgtatctgaaccattgacagatcaaagtaaagaaatacttatacaaaaaattagacctatttcaaaaaaaataggag
ataaaagcaacttacgatatattgaattaacaattattattcagcaagaaatggtaccgtggaatcatcctcccaaacaa
gaatttatttatggagaatggttacaagagctttatgaacaaggatacattcctcagaaggaattaaattcagatttaac
cataatgctttaccaagcaaaacgaaaaaataaaagaatatacggaaattatgacttagaggaattactacctgatattc
cattttctgatgtgagaagagccattatggattcgtcagaggaattaatagataattatcaggatgatgaaaccaactct
atattaactttatgccgtatgattttaactatggacacgggtaaaatcataccaaaagatattgcgggaaatgcagtggc
tgaatcttctccattagaacatagggagagaattttgttagcagttcgtagttatcttggagagaatattgaatggacta
atgaaaatgtaaatttaactataaactatttaaataacagattaaaaaaattataaaaaaattgaaaaaatggtggaaac
acttttttcaatttttttgttttattatttaatatttgggaaatattcattctaattggtaagcgcgccatgggccctgc
agcatgcatatgcatccggagttcccgggcgccggcctaggactagtgatcaccggtcgctcttccgcttcctcgctcac
tgacgcgtaaaaaaggcccacaaaagtgggccttttttctcgctgcgctcggtcgttcggctgcggcgagcggtatcagc
tcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaa
aggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga
cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctc
tcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcac
gctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc
tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaa
caggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagga
cagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc
accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgat
cttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatct
tcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac
caatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgta
gataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccag
atttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtccgataaacccagcgaaccatttgaggtga
taggtaagattataccgaggtatgaaaacgagaattggacctttacagaattactctatgaagcgccatatttaaaaagc
taccaagaaaaaaagcggccaaaaaggcctggtgccaccaggccaaaaaggccgctttttttcgaagaggatgaagagga
tgaggaggcagattgccttgaatatattgacaatactgataagataatatatcttttatatagaagattttcgttcgtga
atacat
//

 

Caution:
Product is for research use only!
 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart