pG5Luc Plasmid


  • Model: PVT1705
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1705  2ug


pG5Luc Plasmid information

Replicon: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cells, mammalian cells, two hybrid vectors
Plasmid size: 4955bp
Prokaryotic resistance: Amp
Clone strain: DH5 alpha
Culture conditions: 37 LB, aerobic
Expression host: mammalian cells
Induction method: no induction, transient expression
Primers for 5'sequencing: Sv40-polyA-R:GAAATTTGTGATGCTATTGC
Primers for 3'sequencing: primers were designed according to the sequence

pG5Luc Plasmid Description

The pG5luc Vector contains five GAL4 binding sites upstream of a minimal TATA box, which in turn is upstream of the firefly luciferase gene. The pGAL4 and pVP16 fusion constructs are transfected along with the pG5luc Vector into mammalian cells. Two to three days after transfection, the cells are lysed, and the amount of Renilla luciferase and firefly luciferase are quantitated using the Dual-Luciferase Reporter Assay System. Interaction between the two test proteins, expressed as GAL4 and VP16 fusion constructs, results in an increase in firefly luciferase expression as compared to the negative controls.


pG5Luc Plasmid Sequence

LOCUS       Exported                4955 bp ds-DNA     circular SYN 06-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4955)


  TITLE     Direct Submission

  JOURNAL   Exported Tuesday, September 6, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..4955

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     CDS             225..1877



                     /product="firefly luciferase"


                     /note="enhanced luc+ version of the luciferase gene"











     polyA_signal    1918..2039

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     rep_origin      complement(2458..3046)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(3217..4077)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(4078..4182)


                     /note="AmpR promoter"

     rep_origin      4209..4664


                     /note="f1 ori"

                     /note="f1 bacteriophage origin of replication; arrow 

                     indicates direction of (+) strand synthesis"

     polyA_signal    4795..4843

                     /note="synthetic polyadenylation signal"

     misc_feature    4857..4948

                     /note="pause site"

                     /note="RNA polymerase II transcriptional pause signal from 

                     the human alpha-2 globin gene"


        1 ggtaccgagt ttctagacgg agtactgtcc tccgagcgga gtactgtcct ccgactcgag

       61 cggagtactg tcctccgatc ggagtactgt cctccgcgaa ttccggagta ctgtcctccg

      121 aagacgctag cggggggcta taaaaggggg tgggggcgtt cgtcctcact ctagatctgc

      181 gatctaagta agcttggcat tccggtactg ttggtaaagc caccatggaa gacgccaaaa

      241 acataaagaa aggcccggcg ccattctatc cgctggaaga tggaaccgct ggagagcaac

      301 tgcataaggc tatgaagaga tacgccctgg ttcctggaac aattgctttt acagatgcac

      361 atatcgaggt ggacatcact tacgctgagt acttcgaaat gtccgttcgg ttggcagaag

      421 ctatgaaacg atatgggctg aatacaaatc acagaatcgt cgtatgcagt gaaaactctc

      481 ttcaattctt tatgccggtg ttgggcgcgt tatttatcgg agttgcagtt gcgcccgcga

      541 acgacattta taatgaacgt gaattgctca acagtatggg catttcgcag cctaccgtgg

      601 tgttcgtttc caaaaagggg ttgcaaaaaa ttttgaacgt gcaaaaaaag ctcccaatca

      661 tccaaaaaat tattatcatg gattctaaaa cggattacca gggatttcag tcgatgtaca

      721 cgttcgtcac atctcatcta cctcccggtt ttaatgaata cgattttgtg ccagagtcct

      781 tcgataggga caagacaatt gcactgatca tgaactcctc tggatctact ggtctgccta

      841 aaggtgtcgc tctgcctcat agaactgcct gcgtgagatt ctcgcatgcc agagatccta

      901 tttttggcaa tcaaatcatt ccggatactg cgattttaag tgttgttcca ttccatcacg

      961 gttttggaat gtttactaca ctcggatatt tgatatgtgg atttcgagtc gtcttaatgt

     1021 atagatttga agaagagctg tttctgagga gccttcagga ttacaagatt caaagtgcgc

     1081 tgctggtgcc aaccctattc tccttcttcg ccaaaagcac tctgattgac aaatacgatt

     1141 tatctaattt acacgaaatt gcttctggtg gcgctcccct ctctaaggaa gtcggggaag

     1201 cggttgccaa gaggttccat ctgccaggta tcaggcaagg atatgggctc actgagacta

     1261 catcagctat tctgattaca cccgaggggg atgataaacc gggcgcggtc ggtaaagttg

     1321 ttccattttt tgaagcgaag gttgtggatc tggataccgg gaaaacgctg ggcgttaatc

     1381 aaagaggcga actgtgtgtg agaggtccta tgattatgtc cggttatgta aacaatccgg

     1441 aagcgaccaa cgccttgatt gacaaggatg gatggctaca ttctggagac atagcttact

     1501 gggacgaaga cgaacacttc ttcatcgttg accgcctgaa gtctctgatt aagtacaaag

     1561 gctatcaggt ggctcccgct gaattggaat ccatcttgct ccaacacccc aacatcttcg

     1621 acgcaggtgt cgcaggtctt cccgacgatg acgccggtga acttcccgcc gccgttgttg

     1681 ttttggagca cggaaagacg atgacggaaa aagagatcgt ggattacgtc gccagtcaag

     1741 taacaaccgc gaaaaagttg cgcggaggag ttgtgtttgt ggacgaagta ccgaaaggtc

     1801 ttaccggaaa actcgacgca agaaaaatca gagagatcct cataaaggcc aagaagggcg

     1861 gaaagatcgc cgtgtaattc tagagtcggg gcggccggcc gcttcgagca gacatgataa

     1921 gatacattga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt

     1981 gtgaaatttg tgatgctatt gctttatttg taaccattat aagctgcaat aaacaagtta

     2041 acaacaacaa ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg gaggtttttt

     2101 aaagcaagta aaacctctac aaatgtggta aaatcgataa ggatccgtcg accgatgccc

     2161 ttgagagcct tcaacccagt cagctccttc cggtgggcgc ggggcatgac tatcgtcgcc

     2221 gcacttatga ctgtcttctt tatcatgcaa ctcgtaggac aggtgccggc agcgctcttc

     2281 cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc

     2341 tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat

     2401 gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt

     2461 ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg

     2521 aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc

     2581 tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt

     2641 ggcgctttct caatgctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa

     2701 gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta

     2761 tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa

     2821 caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa

     2881 ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt

     2941 cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt

     3001 ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat

     3061 cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat

     3121 gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc

     3181 aatctaaagt atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc

     3241 acctatctca gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta

     3301 gataactacg atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga

     3361 cccacgctca ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg

     3421 cagaagtggt cctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc

     3481 tagagtaagt agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat

     3541 cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag

     3601 gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat

     3661 cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa

     3721 ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa

     3781 gtcattctga gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga

     3841 taataccgcg ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg

     3901 gcgaaaactc tcaaggatct taccgctgtt gagatccagt tcgatgtaac ccactcgtgc

     3961 acccaactga tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg

     4021 aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact

     4081 cttccttttt caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat

     4141 atttgaatgt atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt

     4201 gccacctgac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag

     4261 cgtgaccgct acacttgcca gcgccctagc gcccgctcct ttcgctttct tcccttcctt

     4321 tctcgccacg ttcgccggct ttccccgtca agctctaaat cgggggctcc ctttagggtt

     4381 ccgatttagt gctttacggc acctcgaccc caaaaaactt gattagggtg atggttcacg

     4441 tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt

     4501 taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg tctattcttt

     4561 tgatttataa gggattttgc cgatttcggc ctattggtta aaaaatgagc tgatttaaca

     4621 aaaatttaac gcgaatttta acaaaatatt aacgtttaca atttcccatt cgccattcag

     4681 gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagcccaa

     4741 gctaccatga taagtaagta atattaaggt acgggaggta cttggagcgg ccgcaataaa

     4801 atatctttat tttcattaca tctgtgtgtt ggttttttgt gtgaatcgat agtactaaca

     4861 tacgctctcc atcaaaacaa aacgaaacaa aacaaactag caaaataggc tgtccccagt

     4921 gcaagtgcag gtgccagaac atttctctat cgata


Product is for research use only!


Search name

pG5Luc,Plasmid pG5Luc,pG5Luc vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
