pG5Luc Plasmid


  • Model: PVT1705
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pG5Luc,Plasmid pG5Luc,pG5Luc vector

pG5Luc Plasmid information

Replicon: pUC ori, F1 ori
Terminator: SV40 poly (A) signal
Plasmid classification: mammalian cells, mammalian cells, two hybrid vectors
Plasmid size: 4955bp
Prokaryotic resistance: Amp
Clone strain: DH5 alpha
Culture conditions: 37 LB, aerobic
Expression host: mammalian cells
Induction method: no induction, transient expression
Primers for 5'sequencing: Sv40-polyA-R:GAAATTTGTGATGCTATTGC
Primers for 3'sequencing: primers were designed according to the sequence

pG5Luc Plasmid Description

The pG5luc Vector contains five GAL4 binding sites upstream of a minimal TATA box, which in turn is upstream of the firefly luciferase gene. The pGAL4 and pVP16 fusion constructs are transfected along with the pG5luc Vector into mammalian cells. Two to three days after transfection, the cells are lysed, and the amount of Renilla luciferase and firefly luciferase are quantitated using the Dual-Luciferase Reporter Assay System. Interaction between the two test proteins, expressed as GAL4 and VP16 fusion constructs, results in an increase in firefly luciferase expression as compared to the negative controls.


pG5Luc Plasmid Sequence


LOCUS       Exported                4955 bp ds-DNA     circular SYN 06-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4955)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 6, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4955
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             225..1877
                     /product="firefly luciferase"
                     /note="enhanced luc+ version of the luciferase gene"
     polyA_signal    1918..2039
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(2458..3046)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(3217..4077)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4078..4182)
                     /note="AmpR promoter"
     rep_origin      4209..4664
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     polyA_signal    4795..4843
                     /note="synthetic polyadenylation signal"
     misc_feature    4857..4948
                     /note="pause site"
                     /note="RNA polymerase II transcriptional pause signal from 
                     the human alpha-2 globin gene"
        1 ggtaccgagt ttctagacgg agtactgtcc tccgagcgga gtactgtcct ccgactcgag
       61 cggagtactg tcctccgatc ggagtactgt cctccgcgaa ttccggagta ctgtcctccg
      121 aagacgctag cggggggcta taaaaggggg tgggggcgtt cgtcctcact ctagatctgc
      181 gatctaagta agcttggcat tccggtactg ttggtaaagc caccatggaa gacgccaaaa
      241 acataaagaa aggcccggcg ccattctatc cgctggaaga tggaaccgct ggagagcaac
      301 tgcataaggc tatgaagaga tacgccctgg ttcctggaac aattgctttt acagatgcac
      361 atatcgaggt ggacatcact tacgctgagt acttcgaaat gtccgttcgg ttggcagaag
      421 ctatgaaacg atatgggctg aatacaaatc acagaatcgt cgtatgcagt gaaaactctc
      481 ttcaattctt tatgccggtg ttgggcgcgt tatttatcgg agttgcagtt gcgcccgcga
      541 acgacattta taatgaacgt gaattgctca acagtatggg catttcgcag cctaccgtgg
      601 tgttcgtttc caaaaagggg ttgcaaaaaa ttttgaacgt gcaaaaaaag ctcccaatca
      661 tccaaaaaat tattatcatg gattctaaaa cggattacca gggatttcag tcgatgtaca
      721 cgttcgtcac atctcatcta cctcccggtt ttaatgaata cgattttgtg ccagagtcct
      781 tcgataggga caagacaatt gcactgatca tgaactcctc tggatctact ggtctgccta
      841 aaggtgtcgc tctgcctcat agaactgcct gcgtgagatt ctcgcatgcc agagatccta
      901 tttttggcaa tcaaatcatt ccggatactg cgattttaag tgttgttcca ttccatcacg
      961 gttttggaat gtttactaca ctcggatatt tgatatgtgg atttcgagtc gtcttaatgt
     1021 atagatttga agaagagctg tttctgagga gccttcagga ttacaagatt caaagtgcgc
     1081 tgctggtgcc aaccctattc tccttcttcg ccaaaagcac tctgattgac aaatacgatt
     1141 tatctaattt acacgaaatt gcttctggtg gcgctcccct ctctaaggaa gtcggggaag
     1201 cggttgccaa gaggttccat ctgccaggta tcaggcaagg atatgggctc actgagacta
     1261 catcagctat tctgattaca cccgaggggg atgataaacc gggcgcggtc ggtaaagttg
     1321 ttccattttt tgaagcgaag gttgtggatc tggataccgg gaaaacgctg ggcgttaatc
     1381 aaagaggcga actgtgtgtg agaggtccta tgattatgtc cggttatgta aacaatccgg
     1441 aagcgaccaa cgccttgatt gacaaggatg gatggctaca ttctggagac atagcttact
     1501 gggacgaaga cgaacacttc ttcatcgttg accgcctgaa gtctctgatt aagtacaaag
     1561 gctatcaggt ggctcccgct gaattggaat ccatcttgct ccaacacccc aacatcttcg
     1621 acgcaggtgt cgcaggtctt cccgacgatg acgccggtga acttcccgcc gccgttgttg
     1681 ttttggagca cggaaagacg atgacggaaa aagagatcgt ggattacgtc gccagtcaag
     1741 taacaaccgc gaaaaagttg cgcggaggag ttgtgtttgt ggacgaagta ccgaaaggtc
     1801 ttaccggaaa actcgacgca agaaaaatca gagagatcct cataaaggcc aagaagggcg
     1861 gaaagatcgc cgtgtaattc tagagtcggg gcggccggcc gcttcgagca gacatgataa
     1921 gatacattga tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt
     1981 gtgaaattt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
