
  • Model: PVT4018
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4018      2ug


pGADT7-AD Information

Promoter: LEU2, ADH1, T7

Replicator: 2 ori, ori

Plasmid classification: yeast series, yeast two hybrid carrier

Plasmid size: 7987bp

Prokaryotic resistance: Amp

Screening markers: LEU2

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence

Use: Yeast expression


pGADT7-AD Description

pGADT7-AD is a yeast expression vector that is designed to express a protein of interestfused to a GAL4 activation domain (AD; amino acids 768–881). Transcription of the GAL4 ADfusion is driven by the constitutively active ADH1 promoter (PADH1), and is terminated at theADH1 transcription termination signal (TADH1). The GAL4 AD fusion contains an N-terminalSV40 nuclear localization signal (SV40 NLS; 1) that targets the protein to the yeast nucleus,and a hemagglutinin epitope tag (HA Tag), located between the GAL4 AD and the proteinof interest, that allows the protein to be easily detected with HA-tag antibodies.




pGADT7-AD Sequence

LOCUS       Exported                7987 bp ds-DNA     circular SYN 09-SEP-2012

DEFINITION  Yeast two-hybrid ""prey"" vector for expressing proteins fused to 

            the GAL4 activation domain.


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 7987)

  AUTHORS   Clontech

  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..7987

                     /organism="synthetic DNA construct"

                     /lab_host="Saccharomyces cerevisiae"

                     /mol_type="other DNA"

     promoter        771..1475

                     /gene="S. cerevisiae ADH1"

                     /note="ADH1 promoter"

                     /note="promoter for alcohol dehydrogenase 1"

     CDS             1491..1493


                     /product="start codon for expression in yeast"



     CDS             1521..1541


                     /product="nuclear localization signal of SV40 large T 


                     /note="SV40 NLS"


     CDS             1557..1898


                     /gene="Saccharomyces cerevisiae GAL4 (truncated)"

                     /product="activation domain of the GAL4 transcriptional 


                     /note="GAL4 activation domain"




     promoter        1904..1922

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     CDS             1935..1937


                     /product="start codon for in vitro 




     CDS             1941..1967


                     /product="HA (human influenza hemagglutinin) epitope tag"



     misc_feature    1968..2035



                     /note="multiple cloning site"

     terminator      2415..2602

                     /gene="S. cerevisiae ADH1"

                     /note="ADH1 terminator"

                     /note="transcription terminator for alcohol dehydrogenase 


     CDS             complement(2719..3813)


                     /gene="S. cerevisiae LEU2"

                     /product="3-isopropylmalate dehydrogenase, required for 

                     leucine biosynthesis"


                     /note="yeast auxotrophic marker"








     promoter        complement(3814..4219)

                     /gene="S. cerevisiae LEU2"

                     /note="LEU2 promoter"

     primer_bind     complement(4261..4277)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    4285..4301

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(4309..4339)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     rep_origin      complement(4814..5402)



                     /note="high-copy-number colE1/pMB1/pBR322/pUC origin of 


     CDS             complement(5573..6433)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(6434..6538)


                     /note="AmpR promoter"

     rep_origin      6820..7984

                     /note="2u ori"

                     /note="yeast 2u plasmid origin of replication"


        1 tgcatgcctg caggtcgaga tccgggatcg aagaaatgat ggtaaatgaa ataggaaatc

       61 aaggagcatg aaggcaaaag acaaatataa gggtcgaacg aaaaataaag tgaaaagtgt

      121 tgatatgatg tatttggctt tgcggcgccg aaaaaacgag tttacgcaat tgcacaatca

      181 tgctgactct gtggcggacc cgcgctcttg ccggcccggc gataacgctg ggcgtgaggc

      241 tgtgcccggc ggagtttttt gcgcctgcat tttccaaggt ttaccctgcg ctaaggggcg

      301 agattggaga agcaataaga atgccggttg gggttgcgat gatgacgacc acgacaactg

      361 gtgtcattat ttaagttgcc gaaagaacct gagtgcattt gcaacatgag tatactagaa

      421 gaatgagcca agacttgcga gacgcgagtt tgccggtggt gcgaacaata gagcgaccat

      481 gaccttgaag gtgagacgcg cataaccgct agagtacttt gaagaggaaa cagcaatagg

      541 gttgctacca gtataaatag acaggtacat acaacactgg aaatggttgt ctgtttgagt

      601 acgctttcaa ttcatttggg tgtgcacttt attatgttac aatatggaag ggaactttac

      661 acttctccta tgcacatata ttaattaaag tccaatgcta gtagagaagg ggggtaacac

      721 ccctccgcgc tcttttccga tttttttcta aaccgtggaa tatttcggat atccttttgt

      781 tgtttccggg tgtacaatat ggacttcctc ttttctggca accaaaccca tacatcggga

      841 ttcctataat accttcgttg gtctccctaa catgtaggtg gcggagggga gatatacaat

      901 agaacagata ccagacaaga cataatgggc taaacaagac tacaccaatt acactgcctc

      961 attgatggtg gtacataacg aactaatact gtagccctag acttgatagc catcatcata

     1021 tcgaagtttc actacccttt ttccatttgc catctattga agtaataata ggcgcatgca

     1081 acttcttttc tttttttttc ttttctctct cccccgttgt tgtctcacca tatccgcaat

     1141 gacaaaaaaa tgatggaaga cactaaagga aaaaattaac gacaaagaca gcaccaacag

     1201 atgtcgttgt tccagagctg atgaggggta tctcgaagca cacgaaactt tttccttcct

     1261 tcattcacgc acactactct ctaatgagca acggtatacg gccttccttc cagttacttg

     1321 aatttgaaat aaaaaaaagt ttgctgtctt gctatcaagt ataaatagac ctgcaattat

     1381 taatcttttg tttcctcgtc attgttctcg ttccctttct tccttgtttc tttttctgca

     1441 caatatttca agctatacca agcatacaat caactccaag ctttgcaaag atggataaag

     1501 cggaattaat tcccgagcct ccaaaaaaga agagaaaggt cgaattgggt accgccgcca

     1561 attttaatca aagtgggaat attgctgata gctcattgtc cttcactttc actaacagta

     1621 gcaacggtcc gaacctcata acaactcaaa caaattctca agcgctttca caaccaattg

     1681 cctcctctaa cgttcatgat aacttcatga ataatgaaat cacggctagt aaaattgatg

     1741 atggtaataa ttcaaaacca ctgtcacctg gttggacgga ccaaactgcg tataacgcgt

     1801 ttggaatcac tacagggatg tttaatacca ctacaatgga tgatgtatat aactatctat

     1861 tcgatgatga agatacccca ccaaacccaa aaaaagagat ctttaatacg actcactata

     1921 gggcgagcgc cgccatggag tacccatacg acgtaccaga ttacgctcat atggccatgg

     1981 aggccagtga attccacccg ggtgggcatc gatacgggat ccatcgagct cgagctgcag

     2041 atgaatcgta gatactgaaa aaccccgcaa gttcacttca actgtgcatc gtgcaccatc

     2101 tcaatttctt tcatttatac atcgttttgc cttcttttat gtaactatac tcctctaagt

     2161 ttcaatcttg gccatgtaac ctctgatcta tagaattttt taaatgacta gaattaatgc

     2221 ccatcttttt tttggaccta aattcttcat gaaaatatat tacgagggct tattcagaag

     2281 ctttggactt cttcgccaga ggtttggtca agtctccaat caaggttgtc ggcttgtcta

     2341 ccttgccaga aatttacgaa aagatggaaa agggtcaaat cgttggtaga tacgttgttg

     2401 acacttctaa ataagcgaat ttcttatgat ttatgatttt tattattaaa taagttataa

     2461 aaaaaataag tgtatacaaa ttttaaagtg actcttaggt tttaaaacga aaattcttat

     2521 tcttgagtaa ctctttcctg taggtcaggt tgctttctca ggtatagcat gaggtcgctc

     2581 ttattgacca cacctctacc ggccggtcga aattccccta ccctatgaac atattccatt

     2641 ttgtaatttc gtgtcgtttc tattatgaat ttcatttata aagtttatgt acaaatatca

     2701 taaaaaaaga gaatcttttt aagcaaggat tttcttaact tcttcggcga cagcatcacc

     2761 gacttcggtg gtactgttgg aaccacctaa atcaccagtt ctgatacctg catccaaaac

     2821 ctttttaact gcatcttcaa tggccttacc ttcttcaggc aagttcaatg acaatttcaa

     2881 catcattgca gcagacaaga tagtggcgat agggttgacc ttattctttg gcaaatctgg

     2941 agcagaaccg tggcatggtt cgtacaaacc aaatgcggtg ttcttgtctg gcaaagaggc

     3001 caaggacgca gatggcaaca aacccaagga acctgggata acggaggctt catcggagat

     3061 gatatcacca aacatgttgc tggtgattat aataccattt aggtgggttg ggttcttaac

     3121 taggatcatg gcggcagaat caatcaattg atgttgaacc ttcaatgtag gaaattcgtt

     3181 cttgatggtt tcctccacag tttttctcca taatcttgaa gaggccaaaa cattagcttt

     3241 atccaaggac caaataggca atggtggctc atgttgtagg gccatgaaag cggccattct

     3301 tgtgattctt tgcacttctg gaacggtgta ttgttcacta tcccaagcga caccatcacc

     3361 atcgtcttcc tttctcttac caaagtaaat acctcccact aattctctga caacaacgaa

     3421 gtcagtacct ttagcaaatt gtggcttgat tggagataag tctaaaagag agtcggatgc

     3481 aaagttacat ggtcttaagt tggcgtacaa ttgaagttct ttacggattt ttagtaaacc

     3541 ttgttcaggt ctaacactac ctgtacccca tttaggacca cccacagcac ctaacaaaac

     3601 ggcatcagcc ttcttggagg cttccagcgc ctcatctgga agtgggacac ctgtagcttc

     3661 gatagcagca ccaccaatta aatgattttc gaaatcgaac ttgacattgg aacgaacatc

     3721 agaaatagct ttaagaacct taatggcttc ggctgtgatt tcttgaccaa cgtggtcacc

     3781 tggcaaaacg acgatcttct taggggcaga cattagaatg gtatatcctt gaaatatata

     3841 tatatattgc tgaaatgtaa aaggtaagaa aagttagaaa gtaagacgat tgctaaccac

     3901 ctattggaaa aaacaatagg tccttaaata atattgtcaa cttcaagtat tgtgatgcaa

     3961 gcatttagtc atgaacgctt ctctattcta tatgaaaagc cggttccggc gctctcacct

     4021 ttcctttttc tcccaatttt tcagttgaaa aaggtatatg cgtcaggcga cctctgaaat

     4081 taacaaaaaa tttccagtca tcgaatttga ttctgtgcga tagcgcccct gtgtgttctc

     4141 gttatgttga ggaaaaaaat aatggttgct aagagattcg aactcttgca tcttacgata

     4201 cctgagtatt cccacagttg ggggatctcg actctagcta gaggatcaat tcgtaatcat

     4261 gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc

     4321 cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc

     4381 gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctga taacttcgta

     4441 taatgtatgc tatacgaagt tattaggtct gaagaggagt ttacgtccag ccaagctagc

     4501 ttggctgcag gtcgagcggc cgcgatccgg aacccttaat ataacttcgt ataatgtatg

     4561 ctatacgaag ttatcagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc

     4621 gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc

     4681 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata

     4741 acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg

     4801 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct

     4861 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa

     4921 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc

     4981 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt

     5041 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg

     5101 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg

     5161 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct

     5221 tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc

     5281 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg

     5341 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc

     5401 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt

     5461 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa

     5521 aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat

     5581 gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct

     5641 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg

     5701 caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag

     5761 ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta

     5821 attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg

     5881 ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg

     5941 gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct

     6001 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta

     6061 tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg

     6121 gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc

     6181 cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg

     6241 gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga

     6301 tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg

     6361 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat

     6421 gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc

     6481 tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca

     6541 catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct

     6601 ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg tttcggtgat gacggtgaaa

     6661 acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga

     6721 gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc tggcttaact

     6781 atgcggcatc agagcagatt gtactgagag tgcaccataa cgcatttaag cataaacacg

     6841 cactatgccg ttcttctcat gtatatatat atacaggcaa cacgcagata taggtgcgac

     6901 gtgaacagtg agctgtatgt gcgcagctcg cgttgcattt tcggaagcgc tcgttttcgg

     6961 aaacgctttg aagttcctat tccgaagttc ctattctcta gctagaaagt ataggaactt

     7021 cagagcgctt ttgaaaacca aaagcgctct gaagacgcac tttcaaaaaa ccaaaaacgc

     7081 accggactgt aacgagctac taaaatattg cgaataccgc ttccacaaac attgctcaaa

     7141 agtatctctt tgctatatat ctctgtgcta tatccctata taacctaccc atccaccttt

     7201 cgctccttga acttgcatct aaactcgacc tctacatttt ttatgtttat ctctagtatt

     7261 actctttaga caaaaaaatt gtagtaagaa ctattcatag agtgaatcga aaacaatacg

     7321 aaaatgtaaa catttcctat acgtagtata tagagacaaa atagaagaaa ccgttcataa

     7381 ttttctgacc aatgaagaat catcaacgct atcactttct gttcacaaag tatgcgcaat

     7441 ccacatcggt atagaatata atcggggatg cctttatctt gaaaaaatgc acccgcagct

     7501 tcgctagtaa tcagtaaacg cgggaagtgg agtcaggctt tttttatgga agagaaaata

     7561 gacaccaaag tagccttctt ctaaccttaa cggacctaca gtgcaaaaag ttatcaagag

     7621 actgcattat agagcgcaca aaggagaaaa aaagtaatct aagatgcttt gttagaaaaa

     7681 tagcgctctc gggatgcatt tttgtagaac aaaaaagaag tatagattct ttgttggtaa

     7741 aatagcgctc tcgcgttgca tttctgttct gtaaaaatgc agctcagatt ctttgtttga

     7801 aaaattagcg ctctcgcgtt gcatttttgt tttacaaaaa tgaagcacag attcttcgtt

     7861 ggtaaaatag cgctttcgcg ttgcatttct gttctgtaaa aatgcagctc agattctttg

     7921 tttgaaaaat tagcgctctc gcgttgcatt tttgttctac aaaatgaagc acagatgctt

     7981 cgttgct


Product is for research use only!


Search name

pGADT7-AD,Plasmid pGADT7-AD,pGADT7-AD vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
