pGADT7- AD Plasmid


  • Model: PVT4018
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGADT7-AD,Plasmid pGADT7-AD,pGADT7-AD vector


pGADT7-AD Information

Promoter: LEU2, ADH1, T7

Replicator: 2 ori, ori

Plasmid classification: yeast series, yeast two hybrid carrier

Plasmid size: 7987bp

Prokaryotic resistance: Amp

Screening markers: LEU2

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence

Use: Yeast expression


pGADT7-AD Description

pGADT7-AD is a yeast expression vector that is designed to express a protein of interestfused to a GAL4 activation domain (AD; amino acids 768–881). Transcription of the GAL4 ADfusion is driven by the constitutively active ADH1 promoter (PADH1), and is terminated at theADH1 transcription termination signal (TADH1). The GAL4 AD fusion contains an N-terminalSV40 nuclear localization signal (SV40 NLS; 1) that targets the protein to the yeast nucleus,and a hemagglutinin epitope tag (HA Tag), located between the GAL4 AD and the proteinof interest, that allows the protein to be easily detected with HA-tag antibodies.




pGADT7-AD Sequence

LOCUS       Exported                7987 bp ds-DNA     circular SYN 09-SEP-2012
DEFINITION  Yeast two-hybrid ""prey"" vector for expressing proteins fused to 
            the GAL4 activation domain.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7987)
  AUTHORS   Clontech
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..7987
                     /organism="synthetic DNA construct"
                     /lab_host="Saccharomyces cerevisiae"
                     /mol_type="other DNA"
     promoter        771..1475
                     /gene="S. cerevisiae ADH1"
                     /note="ADH1 promoter"
                     /note="promoter for alcohol dehydrogenase 1"
     CDS             1491..1493
                     /product="start codon for expression in yeast"
     CDS             1521..1541
                     /product="nuclear localization signal of SV40 large T 
                     /note="SV40 NLS"
     CDS             1557..1898
                     /gene="Saccharomyces cerevisiae GAL4 (truncated)"
                     /product="activation domain of the GAL4 transcriptional 
                     /note="GAL4 activation domain"
     promoter        1904..1922
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             1935..1937
                     /product="start codon for in vitro 
     CDS             1941..1967
                     /product="HA (human influenza hemagglutinin) epitope tag"
     misc_feature    1968..2035
                     /note="multiple cloning site"
     terminator      2415..2602
                     /gene="S. cerevisiae ADH1"
                     /note="ADH1 terminator"
                     /note="transcription terminator for alcohol dehydrogenase 
     CDS             complement(2719..3813)
                     /gene="S. cerevisiae LEU2"
                     /product="3-isopropylmalate dehydrogenase, required for 
                     leucine biosynthesis"
                     /note="yeast auxotrophic marker"
     promoter        complement(3814..4219)
                     /gene="S. cerevisiae LEU2"
                     /note="LEU2 promoter"
     primer_bind     complement(4261..4277)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     protein_bind    4285..4301
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4309..4339)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
