pGADT7- Rec Plasmid


  • Model: PVT4025
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGADT7-Rec,Plasmid pGADT7-Rec,pGADT7-Rec vector

pGADT7-Rec Plasmid information

Promoter: T7, ADH1 promoter
Replicator: 2 ori, ori
Plasmid classification: yeast series, yeast single hybrid carrier
Plasmid size: 8058bp
Prokaryotic resistance: ampicillin Amp
Screening markers: LEU2
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
Expression host: yeast cells
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: primers designed according to sequence
Use: Yeast expression




pGADT7-Rec Plasmid Sequence

LOCUS       Exported                8058 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 22
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8058)
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..8058
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     rep_origin      4..1168
                     /note="2u ori"
                     /note="yeast 2u plasmid origin of replication"
     promoter        1450..1554
                     /note="AmpR promoter"
     CDS             1555..2415
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2586..3174
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     protein_bind    3414..3447
                     /bound_moiety="Cre recombinase"
                     /note="Cre-mediated recombination occurs in the 8-bp core 
                     sequence (GCATACAT)."
     protein_bind    3525..3558
                     /bound_moiety="Cre recombinase"
                     /note="Cre-mediated recombination occurs in the 8-bp core 
                     sequence (GCATACAT)."
     protein_bind    3613..3634
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        3649..3679
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    3687..3703
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     3711..3727
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     promoter        3769..4174
                     /gene="S. cerevisiae LEU2"
                     /note="LEU2 promoter"
     CDS             4175..5269
                     /gene="S. cerevisiae LEU2"
                     /product="3-isopropylmalate dehydrogenase, required for 
                     leucine biosynthesis"
                     /note="yeast auxotrophic marker"
     terminator      5386..5573
                     /gene="S. cerevisiae ADH1"
                     /note="ADH1 terminator"
                     /note="transcription terminator for the S. cerevisiae 
                     alcohol dehydrogenase 1 (ADH1) gene"
     CDS             complement(6092..6118)
                     /product="HA (human influenza hemagglutinin) epitope tag"
     promoter        complement(6137..6155)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             complement(6161..6502)
                     /gene="Saccharomyces cerevisiae GAL4 (truncated)"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
