pGADT7-T

Search name

pGADT7-T,Plasmid pGADT7-T,pGADT7-T vector

 

pGADT7-T Information

Promoter: T7, ADH1

Replicator: 2 ori, ori

Plasmid classification: yeast series, yeast two hybrid carrier

Plasmid size: 10.kb

Prokaryotic resistance: Amp

Screening markers: LEU2

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

5'sequencing primers: T7:TAATACGACTCACTATAGGG

3'sequencing primers: primers designed according to sequence

Use: Yeast expression

 

 

pGADT7-T Description

pGADT7-T encodes a fusion of the SV40 large T-antigen (a.a. 86–708) and the GAL4 AD (a.a. 768–881). The SV40 large T DNA (GenBank Locus SV4CG) was derived from a plasmid referenced in Li & Fields (1993) and was cloned into pGADT7 using the EcoR I and Xho I sites. pGADT7-T has not been sequenced.