

  • Model: PVT4025
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT4025    2ug

pGADT7-Rec information

Promoter: T7, ADH1 promoter
Replicator: 2 ori, ori
Plasmid classification: yeast series, yeast single hybrid carrier
Plasmid size: 8058bp
Prokaryotic resistance: ampicillin Amp
Screening markers: LEU2
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
Expression host: yeast cells
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: primers designed according to sequence
Use: Yeast expression




pGADT7-Rec Sequence

LOCUS       Exported                8058 bp ds-DNA     circular SYN 10-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 22

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 8058)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..8058

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     rep_origin      4..1168

                     /note="2u ori"

                     /note="yeast 2u plasmid origin of replication"

     promoter        1450..1554


                     /note="AmpR promoter"

     CDS             1555..2415





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      2586..3174



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     protein_bind    3414..3447

                     /bound_moiety="Cre recombinase"


                     /note="Cre-mediated recombination occurs in the 8-bp core 

                     sequence (GCATACAT)."

     protein_bind    3525..3558

                     /bound_moiety="Cre recombinase"


                     /note="Cre-mediated recombination occurs in the 8-bp core 

                     sequence (GCATACAT)."

     protein_bind    3613..3634

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        3649..3679

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    3687..3703

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     3711..3727

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     promoter        3769..4174

                     /gene="S. cerevisiae LEU2"

                     /note="LEU2 promoter"

     CDS             4175..5269


                     /gene="S. cerevisiae LEU2"

                     /product="3-isopropylmalate dehydrogenase, required for 

                     leucine biosynthesis"


                     /note="yeast auxotrophic marker"








     terminator      5386..5573

                     /gene="S. cerevisiae ADH1"

                     /note="ADH1 terminator"

                     /note="transcription terminator for the S. cerevisiae 

                     alcohol dehydrogenase 1 (ADH1) gene"

     CDS             complement(6092..6118)


                     /product="HA (human influenza hemagglutinin) epitope tag"



     promoter        complement(6137..6155)

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     CDS             complement(6161..6502)


                     /gene="Saccharomyces cerevisiae GAL4 (truncated)"

                     /product="activation domain of the GAL4 transcriptional 


                     /note="GAL4 activation domain"




     CDS             complement(6518..6538)


                     /product="nuclear localization signal of SV40 large T 


                     /note="SV40 NLS"


     promoter        complement(6584..7288)

                     /gene="S. cerevisiae ADH1"

                     /note="ADH1 promoter"

                     /note="promoter for alcohol dehydrogenase 1"


        1 agcaacgaag catctgtgct tcattttgta gaacaaaaat gcaacgcgag agcgctaatt

       61 tttcaaacaa agaatctgag ctgcattttt acagaacaga aatgcaacgc gaaagcgcta

      121 ttttaccaac gaagaatctg tgcttcattt ttgtaaaaca aaaatgcaac gcgagagcgc

      181 taatttttca aacaaagaat ctgagctgca tttttacaga acagaaatgc aacgcgagag

      241 cgctatttta ccaacaaaga atctatactt cttttttgtt ctacaaaaat gcatcccgag

      301 agcgctattt ttctaacaaa gcatcttaga ttactttttt tctcctttgt gcgctctata

      361 atgcagtctc ttgataactt tttgcactgt aggtccgtta aggttagaag aaggctactt

      421 tggtgtctat tttctcttcc ataaaaaaag cctgactcca cttcccgcgt ttactgatta

      481 ctagcgaagc tgcgggtgca ttttttcaag ataaaggcat ccccgattat attctatacc

      541 gatgtggatt gcgcatactt tgtgaacaga aagtgatagc gttgatgatt cttcattggt

      601 cagaaaatta tgaacggttt cttctatttt gtctctatat actacgtata ggaaatgttt

      661 acattttcgt attgttttcg attcactcta tgaatagttc ttactacaat ttttttgtct

      721 aaagagtaat actagagata aacataaaaa atgtagaggt cgagtttaga tgcaagttca

      781 aggagcgaaa ggtggatggg taggttatat agggatatag cacagagata tatagcaaag

      841 agatactttt gagcaatgtt tgtggaagcg gtattcgcaa tattttagta gctcgttaca

      901 gtccggtgcg tttttggttt tttgaaagtg cgtcttcaga gcgcttttgg ttttcaaaag

      961 cgctctgaag ttcctatact ttctagctag agaataggaa cttcggaata ggaacttcaa

     1021 agcgtttccg aaaacgagcg cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac

     1081 tgttcacgtc gcacctatat ctgcgtgttg cctgtatata tatatacatg agaagaacgg

     1141 catagtgcgt gtttatgctt aaatgcgtta tggtgcactc tcagtacaat ctgctctgat

     1201 gccgcatagt taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct

     1261 tgtctgctcc cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt

     1321 cagaggtttt caccgtcatc accgaaacgc gcgagacgaa agggcctcgt gatacgccta

     1381 tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg

     1441 ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg

     1501 ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt

     1561 attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt

     1621 gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg

     1681 ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa

     1741 cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt

     1801 gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag

     1861 tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt

     1921 gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga

     1981 ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt

     2041 tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta

     2101 gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg

     2161 caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc

     2221 cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt

     2281 atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg

     2341 gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg

     2401 attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa

     2461 cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa

     2521 atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga

     2581 tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg

     2641 ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact

     2701 ggcttcagca gagcgcagat accaaatact gttcttctag tgtagccgta gttaggccac

     2761 cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg

     2821 gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg

     2881 gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga

     2941 acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc

     3001 gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg

     3061 agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc

     3121 tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc

     3181 agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt

     3241 cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc

     3301 gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc

     3361 ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctgataactt

     3421 cgtatagcat acattatacg aagttatatt aagggttccg gatcgcggcc gctcgacctg

     3481 cagccaagct agcttggctg gacgtaaact cctcttcaga cctaataact tcgtatagca

     3541 tacattatac gaagttatca gctggcacga caggtttccc gactggaaag cgggcagtga

     3601 gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt tacactttat

     3661 gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag

     3721 ctatgacatg attacgaatt gatcctctag ctagagtcga gatcccccaa ctgtgggaat

     3781 actcaggtat cgtaagatgc aagagttcga atctcttagc aaccattatt tttttcctca

     3841 acataacgag aacacacagg ggcgctatcg cacagaatca aattcgatga ctggaaattt

     3901 tttgttaatt tcagaggtcg cctgacgcat ataccttttt caactgaaaa attgggagaa

     3961 aaaggaaagg tgagagcgcc ggaaccggct tttcatatag aatagagaag cgttcatgac

     4021 taaatgcttg catcacaata cttgaagttg acaatattat ttaaggacct attgtttttt

     4081 ccaataggtg gttagcaatc gtcttacttt ctaacttttc ttacctttta catttcagca

     4141 atatatatat atatttcaag gatataccat tctaatgtct gcccctaaga agatcgtcgt

     4201 tttgccaggt gaccacgttg gtcaagaaat cacagccgaa gccattaagg ttcttaaagc

     4261 tatttctgat gttcgttcca atgtcaagtt cgatttcgaa aatcatttaa ttggtggtgc

     4321 tgctatcgaa gctacaggtg tcccacttcc agatgaggcg ctggaagcct ccaagaaggc

     4381 tgatgccgtt ttgttaggtg ctgtgggtgg tcctaaatgg ggtacaggta gtgttagacc

     4441 tgaacaaggt ttactaaaaa tccgtaaaga acttcaattg tacgccaact taagaccatg

     4501 taactttgca tccgactctc ttttagactt atctccaatc aagccacaat ttgctaaagg

     4561 tactgacttc gttgttgtca gagaattagt gggaggtatt tactttggta agagaaagga

     4621 agacgatggt gatggtgtcg cttgggatag tgaacaatac accgttccag aagtgcaaag

     4681 aatcacaaga atggccgctt tcatggccct acaacatgag ccaccattgc ctatttggtc

     4741 cttggataaa gctaatgttt tggcctcttc aagattatgg agaaaaactg tggaggaaac

     4801 catcaagaac gaatttccta cattgaaggt tcaacatcaa ttgattgatt ctgccgccat

     4861 gatcctagtt aagaacccaa cccacctaaa tggtattata atcaccagca acatgtttgg

     4921 tgatatcatc tccgatgaag cctccgttat cccaggttcc ttgggtttgt tgccatctgc

     4981 gtccttggcc tctttgccag acaagaacac cgcatttggt ttgtacgaac catgccacgg

     5041 ttctgctcca gatttgccaa agaataaggt caaccctatc gccactatct tgtctgctgc

     5101 aatgatgttg aaattgtcat tgaacttgcc tgaagaaggt aaggccattg aagatgcagt

     5161 taaaaaggtt ttggatgcag gtatcagaac tggtgattta ggtggttcca acagtaccac

     5221 cgaagtcggt gatgctgtcg ccgaagaagt taagaaaatc cttgcttaaa aagattctct

     5281 ttttttatga tatttgtaca taaactttat aaatgaaatt cataatagaa acgacacgaa

     5341 attacaaaat ggaatatgtt catagggtag gggaatttcg accggccggt agaggtgtgg

     5401 tcaataagag cgacctcatg ctatacctga gaaagcaacc tgacctacag gaaagagtta

     5461 ctcaagaata agaattttcg ttttaaaacc taagagtcac tttaaaattt gtatacactt

     5521 atttttttta taacttattt aataataaaa atcataaatc ataagaaatt cgcttattta

     5581 gaagtgtcaa caacgtatct accaacgatt tgaccctttt ccatcttttc gtaaatttct

     5641 ggcaaggtag acaagccgac aaccttgatt ggagacttga ccaaacctct ggcgaagaag

     5701 tccaaagctt ctgaataagc cctcgtaata tattttcatg aagaatttag gtccaaaaaa

     5761 aagatgggca ttaattctag tcatttaaaa aattctatag atcagaggtt acatggccaa

     5821 gattgaaact tagaggagta tagttacata aaagaaggca aaacgatgta taaatgaaag

     5881 aaattgagat ggtgcacgat gcacagttga agtgaacttg cggggttttt cagtatctac

     5941 gattcatctg cagctcgagc tcgatggatc ccgtatcgat gcccaccctc tagaggccga

     6001 ggcggccgac atgttttttc ccgggccata atggccactc tgcgttgata ccactgcttg

     6061 ggtggaattc actggcctcc atggccatat gagcgtaatc tggtacgtcg tatgggtact

     6121 ccatggcggc gctcgcccta tagtgagtcg tattaaagat ctcttttttt gggtttggtg

     6181 gggtatcttc atcatcgaat agatagttat atacatcatc cattgtagtg gtattaaaca

     6241 tccctgtagt gattccaaac gcgttatacg cagtttggtc cgtccaacca ggtgacagtg

     6301 gttttgaatt attaccatca tcaattttac tagccgtgat ttcattattc atgaagttat

     6361 catgaacgtt agaggaggca attggttgtg aaagcgcttg agaatttgtt tgagttgtta

     6421 tgaggttcgg accgttgcta ctgttagtga aagtgaagga caatgagcta tcagcaatat

     6481 tcccactttg attaaaattg gcggcggtac ccaattcgac ctttctcttc ttttttggag

     6541 gctcgggaat taattccgct ttatccatct ttgcaaagct tggagttgat tgtatgcttg

     6601 gtatagcttg aaatattgtg cagaaaaaga aacaaggaag aaagggaacg agaacaatga

     6661 cgaggaaaca aaagattaat aattgcaggt ctatttatac ttgatagcaa gacagcaaac

     6721 ttttttttat ttcaaattca agtaactgga aggaaggccg tataccgttg ctcattagag

     6781 agtagtgtgc gtgaatgaag gaaggaaaaa gtttcgtgtg cttcgagata cccctcatca

     6841 gctctggaac aacgacatct gttggtgctg tctttgtcgt taattttttc ctttagtgtc

     6901 ttccatcatt tttttgtcat tgcggatatg gtgagacaac aacgggggag agagaaaaga

     6961 aaaaaaaaga aaagaagttg catgcgccta ttattacttc aatagatggc aaatggaaaa

     7021 agggtagtga aacttcgata tgatgatggc tatcaagtct agggctacag tattagttcg

     7081 ttatgtacca ccatcaatga ggcagtgtaa ttggtgtagt cttgtttagc ccattatgtc

     7141 ttgtctggta tctgttctat tgtatatctc ccctccgcca cctacatgtt agggagacca

     7201 acgaaggtat tataggaatc ccgatgtatg ggtttggttg ccagaaaaga ggaagtccat

     7261 attgtacacc cggaaacaac aaaaggatat ccgaaatatt ccacggttta gaaaaaaatc

     7321 ggaaaagagc gcggaggggt gttacccccc ttctctacta gcattggact ttaattaata

     7381 tatgtgcata ggagaagtgt aaagttccct tccatattgt aacataataa agtgcacacc

     7441 caaatgaatt gaaagcgtac tcaaacagac aaccatttcc agtgttgtat gtacctgtct

     7501 atttatactg gtagcaaccc tattgctgtt tcctcttcaa agtactctag cggttatgcg

     7561 cgtctcacct tcaaggtcat ggtcgctcta ttgttcgcac caccggcaaa ctcgcgtctc

     7621 gcaagtcttg gctcattctt ctagtatact catgttgcaa atgcactcag gttctttcgg

     7681 caacttaaat aatgacacca gttgtcgtgg tcgtcatcat cgcaacccca accggcattc

     7741 ttattgcttc tccaatctcg ccccttagcg cagggtaaac cttggaaaat gcaggcgcaa

     7801 aaaactccgc cgggcacagc ctcacgccca gcgttatcgc cgggccggca agagcgcggg

     7861 tccgccacag agtcagcatg attgtgcaat tgcgtaaact cgttttttcg gcgccgcaaa

     7921 gccaaataca tcatatcaac acttttcact ttatttttcg ttcgaccctt atatttgtct

     7981 tttgccttca tgctccttga tttcctattt catttaccat catttcttcg atcccggatc

     8041 tcgacctgca ggcatgca


Product is for research use only!


Search name

pGADT7-Rec,Plasmid pGADT7-Rec,pGADT7-Rec vector


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
