pGAPZA

Search name

pGAPZA,Plasmid pGAPZA,pGAPZA vector

 

pGAPZA Information

Promoter: GAP

Replicon: pUC ori

Terminator: AOX1 TT

Plasmid classification: yeast series, Pichia pastoris expression vector.

Plasmid size: 2884bp

Plasmid label: C-Myc, C-His

Prokaryotic resistance: Zeo

Screening markers: Zeo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Culture conditions: 28 C, YPD

Induction mode: no induction, instantaneous expression

5'sequencing primers: pGAP-F:GTCCCTATTTCAATCAATTGAA

3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

Use: Yeast expression

pGAPZA Description

Glyceraldehyde -3- phosphate dehydrogenase (GAPDH) enzyme is stable and highly expressed in many biological cells including Pichia pastoris. Recently, the GAPDH protein coding gene promoter (GAP) has been studied in depth and can be expressed in high water in Pichia pastoris, depending on the use of carbon sources (Waterham et al., 1997). The expression level of GAP promoter (PGAP) is slightly higher than that of AOX1 promoter.

PGAPZ A, B and C vectors (2.9 KB) and pGAPZ alpha, B and C (3.1 KB) vectors use GAP promoter to express recombinant protein in Pichia pastoris. The recombinant protein was expressed as a fusion protein with C- terminal myc epitope and C terminal His tag. In addition, the fusion protein expressed by pGAPZ alpha at the N- end contains the alpha factor secreting signal peptide of Saccharomyces cerevisiae (Saccharomyces cerevisiae). These two series of carriers provide three different reading frame carriers to facilitate cloning of vectors carrying C- terminal tags and / or N- terminal secretory signal peptides. These vectors are based on dominant selection markers, and Zeocin (bleomycin) screening markers can be applied to Pichia pastoris and Escherichia coli simultaneously.

 

 

pGAPZA Sequence