pGAPZA Plasmid


  • Model: PVT4009
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGAPZA,Plasmid pGAPZA,pGAPZA vector


pGAPZA Information

Promoter: GAP

Replicon: pUC ori

Terminator: AOX1 TT

Plasmid classification: yeast series, Pichia pastoris expression vector.

Plasmid size: 2884bp

Plasmid label: C-Myc, C-His

Prokaryotic resistance: Zeo

Screening markers: Zeo

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: yeast cells

Culture conditions: 28 C, YPD

Induction mode: no induction, instantaneous expression


3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT

Use: Yeast expression


pGAPZA Description

Glyceraldehyde -3- phosphate dehydrogenase (GAPDH) enzyme is stable and highly expressed in many biological cells including Pichia pastoris. Recently, the GAPDH protein coding gene promoter (GAP) has been studied in depth and can be expressed in high water in Pichia pastoris, depending on the use of carbon sources (Waterham et al., 1997). The expression level of GAP promoter (PGAP) is slightly higher than that of AOX1 promoter.

PGAPZ A, B and C vectors (2.9 KB) and pGAPZ alpha, B and C (3.1 KB) vectors use GAP promoter to express recombinant protein in Pichia pastoris. The recombinant protein was expressed as a fusion protein with C- terminal myc epitope and C terminal His tag. In addition, the fusion protein expressed by pGAPZ alpha at the N- end contains the alpha factor secreting signal peptide of Saccharomyces cerevisiae (Saccharomyces cerevisiae). These two series of carriers provide three different reading frame carriers to facilitate cloning of vectors carrying C- terminal tags and / or N- terminal secretory signal peptides. These vectors are based on dominant selection markers, and Zeocin (bleomycin) screening markers can be applied to Pichia pastoris and Escherichia coli simultaneously.



pGAPZA Sequence

LOCUS       Exported                2884 bp ds-DNA     circular SYN 10-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 8
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 2884)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 10, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..2884
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        7..483
                     /note="GAP promoter"
                     /note="promoter for Pichia pastoris 
                     glyceraldehyde-3-phosphate dehydrogenase"
     CDS             564..593
                     /product="Myc (human c-Myc oncogene) epitope tag"
     CDS             609..626
                     /product="6xHis affinity tag"
     terminator      705..951
                     /gene="Pichia pastoris AOX1"
                     /note="AOX1 terminator"
                     /note="transcription terminator for AOX1"
     promoter        966..1377
                     /gene="S. cerevisiae TEF1"
                     /note="TEF1 promoter"
                     /note="promoter for EF-1-alpha"
     promoter        1384..1431
                     /note="EM7 promoter"
                     /note="synthetic bacterial promoter "
     CDS             1450..1824
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     terminator      1890..2137
                     /gene="S. cerevisiae CYC1"
                     /note="CYC1 terminator"
                     /note="transcription terminator for CYC1"
     rep_origin      complement(2212..2800)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
        1 agatcttttt tgtagaaatg tcttggtgtc ctcgtccaat caggtagcca tctctgaaat
       61 atctggctcc gttgcaactc cgaacgacct gctggcaacg taaaattctc cggggtaaaa
      121 cttaaatgtg gagtaatgga accagaaacg tctcttccct tctctctcct tccaccgccc
      181 gttaccgtcc ctaggaaatt ttactctgct ggagagcttc ttctacggcc cccttgcagc
      241 aatgctcttc ccagcattac gttgcgggta aaacggaggt cgtgtacccg acctagcagc
      301 ccagggatgg aaaagtcccg gccgtcgctg gcaataatag cgggcggacg catgtcatga
      361 gattattgga aaccaccaga atcgaatata aaaggcgaac acctttccca attttggttt
      421 ctcctgaccc aaagacttta aatttaattt atttgtccct atttcaatca attgaacaac
      481 tatttcgaaa cgaggaattc acgtggccca gccggccgtc tcggatcggt acctcgagcc
      541 gcggcggccg ccagcttggg cccgaacaaa aactcatctc agaagaggat ctgaatagcg
      601 ccgtcgacca tcatcatcat catcattgag ttttagcctt agacatgact gttcctcagt
      661 tcaagttggg cacttacgag aagaccggtc ttgctagatt ctaatcaaga ggatgtcaga
      721 atgccatttg cctgagagat gcaggcttca tttttgatac ttttttattt gtaacctata
      781 tagtatagga ttttttttgt cattttgttt cttctcgtac gagcttgctc ctgatcagcc
      841 tatctcgcag ctgatgaata tcttgtggta ggggtttggg aaaatcattc gagtttgatg
      901 tttttcttgg tatttcccac tcctcttcag agtacagaag attaagtgag accttcgttt
      961 gtgcggatcc cccacacacc atagcttcaa aatgtttcta ctcctttttt actcttccag
     1021 attttctcgg actccgcgca tcgccgtacc acttcaaaac acccaagcac agcatactaa
     1081 attttccctc tttcttcctc tagggtgtcg ttaattaccc gtactaaagg tttggaaaag
     1141 aaaaaagaga ccgcctcgtt tctttttctt cgtcgaaaaa ggcaataaaa atttttatca
     1201 cgtttctttt tcttgaaatt ttttttttta gtttttttct ctttcagtga cctccattga
     1261 tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta
     1321 ttacaacttt ttttacttct tgttcattag aaagaaagca tagcaatcta atctaagggc
     1381 ggtgttgaca attaatcatc ggcatagtat atcggcatag tataatacga caaggtgagg
     1441 aactaaacca tggccaagtt gaccagtgcc gttccggtgc tcaccgcgcg cgacgtcgcc
     1501 ggagcggtcg agttctggac cgaccggctc gggttctccc gggacttcgt ggaggacgac
     1561 ttcgccggtg tggtccggga cgacgtgacc ctgttcatca gcgcggtcca ggaccaggtg
     1621 gtgccggaca acaccctggc ctgggtgtgg gtgcgcggcc tggacgagct gtacgccgag
     1681 tggtcggagg tcgtgtccac gaacttccgg gacgcctccg ggccggccat gaccgagatc
     1741 ggcgagcagc cgtgggggcg ggagttcgcc ctgcgcgacc cggccggcaa ctgcgtgcac
     1801 ttcgtggccg aggagcagga ctgacacgtc cgacggcggc ccacgggtcc caggcctcgg
     1861 agatccgtcc cccttttcct ttgtcgatat catgtaatta gttatgtcac gcttacattc
     1921 acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac ctgaagtcta
     1981 ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta tatttcaaat
     2041 ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac attatactga aaaccttgct
     2101 tgagaaggtt ttgggacgct cgaaggcttt aatttgcaag ctggagacca acatgtgagc
     2161 aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag
     2221 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc
     2281 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt
     2341 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct
     2401 ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg
     2461 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct
     2521 tg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
