pGBKT7-53

$182.00

  • Model: PVT4019
  • 50 Units in Stock
Ask a question


Add to Cart:

pGBKT7-53

PVT4019 2ug

 

pGBKT7-53 Information

Promoter: ADH1, TRP1, T7
Replicator: 2 ori, ori, FI ori
Plasmid classification: yeast series, yeast two hybrid carrier
Plasmid size: 8.3kb
Prokaryotic resistance: Kan
Screening markers: TRP1
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic LB
Expression host: yeast cells
5'sequencing primers: T7:TAATACGACTCACTATAGGG
3'sequencing primers: primers designed according to sequence
Use: Yeast expression

 

pGBKT7-53 Description

Yeast two-hybrid systems provide a sensitive method for detecting relatively weak and transient protein interactions. Such interactions may not be biochemically detectable, but may be critical for proper functioning of complex biological systems. pGBKT7-53 and pGADT7-T encode fusions between the GAL4 DNA-BD and AD and murine p53 and SV40 large T-antigen, respectively. p53 and large T-antigen interact in a yeast two-hybrid assay.

 

pGBKT7-53 Sequence  

cggtgcgggcctcttcgctattacgccagatccttttgttgtttccgggtgtacaatatggacttcctcttttctggcaa
ccaaacccatacatcgggattcctataataccttcgttggtctccctaacatgtaggtggcggaggggagatatacaata
gaacagataccagacaagacataatgggctaaacaagactacaccaattacactgcctcattgatggtggtacataacga
actaatactgtagccctagacttgatagccatcatcatatcgaagtttcactaccctttttccatttgccatctattgaa
gtaataataggcgcatgcaacttcttttctttttttttcttttctctctcccccgttgttgtctcaccatatccgcaatg
acaaaaaaaatgatggaagacactaaaggaaaaaattaacgacaaagacagcaccaacagatgtcgttgttccagagctg
atgaggggtatctcgaagcacacgaaactttttccttccttcattcacgcacactactctctaatgagcaacggtatacg
gccttccttccagttacttgaatttgaaataaaaaaagtttgctgtcttgctatcaagtataaatagacctgcaattatt
aatcttttgtttcctcgtcattgttctcgttccctttcttccttgtttctttttctgcacaatatttcaagctataccaa
gcatacaatcaactccaagcttgaagcaagcctcctgaaagatgaagctactgtcttctatcgaacaagcatgcgatatt
tgccgacttaaaaagctcaagtgctccaaagaaaaaccgaagtgcgccaagtgtctgaagaacaactgggagtgtcgcta
ctctcccaaaaccaaaaggtctccgctgactagggcacatctgacagaagtggaatcaaggctagaaagactggaacagc
tatttctactgatttttcctcgagaagaccttgacatgattttgaaaatggattctttacaggatataaaagcattgtta
acaggattatttgtacaagataatgtgaataaagatgccgtcacagatagattggcttcagtggagactgatatgcctct
aacattgagacagcatagaataagtgcgacatcatcatcggaagagagtagtaacaaaggtcaaagacagttgactgtat
cgccggaatttgtaatacgactcactatagggcgagccgccatcatggaggagcagaagctgatctcagaggaggacctg
catATGGCCATGGAGGCCGAATTCCCTGTCACCGAGACCCCTGGGCCAGTGGCCCCTGCCCCAGCCACTCCATGGCCCCT
GTCATCTTTTGTCCCTTCTCAAAAAACTTACCAGGGCAACTATGGCTTCCACCTGGGCTTCCTGCAGTCTGGGACAGCCA
AGTCTGTTATGTGCACGTACTCTCCTCCCCTCAATAAGCTATTCTGCCAGCTGGCGAAGACGTGCCCTGTGCAGTTGTGG
GTCAGCGCCACACCTCCAGCTGGGAGCCGTGTCCGCGCCATGGCCATCTACAAGAAGTCACAGCACATGACGGAGGTCGT
GAGACGCTGCCCCCACCATGAGCGCTGCTCCGATGGTGATGGCCTGGCTCCTCCCCAGCATCTTATCCGGGTGGAAGGAA
ATTTGTATCCCGAGTATCTGGAAGACAGGCAGACTTTTCGCCACAGCGTGGTGGTACCTTATGAGCCACCCGAGGCCGGC
TCTGAGTATACCACCATCCACTACAAGTACATGTGTAATAGCTCCTGCATGGGGGGCATGAACCGCCGACCTATCCTTAC
CATCATCACACTGGAAGACTCCAGTGGGAACCTTCTGGGACGGGACAGCTTTGAGGTTCGTGTTTGTGCCTGCCCTGGGA
GAGACCGCCGTACAGAAGAAGAAAATTTCCGCAAAAAGGAAGTCCTTTGCCCTGAACTGCCCCCAGGGAGCGCAAAGAGA
GCGCTGCCCACCTGCACAAGCGCCTCTCCCCCGCAAAAGAAAAAACCACTTGATGGAGAGTATTTCACCCTCAAGATCCG
CGGGCGTAAACGCTTCGAGATGTTCCGGGAGCTGAATGAGGCCTTAGAGTTAAAGGATGCCCATGCTACAGAGGAGTCTG
GAGACAGCAGGGCTCACTCCAGCTACCTGAAGACCAAGAAGGGCCAGTCTACTTCCCGCCATAAAAAAACAATGGTCAAG
AAAGTGGGGCCTGACTCAGACTGACTGCCTCTGCATCCCggatccgtcgacctgcagcggccgcataactagcataaccc
cttggggcctctaaacgggtcttgaggggttttttgcgcgcttgcagccaagctaattccgggcgaatttcttatgattt
atgatttttattattaaataagttataaaaaaaataagtgtatacaaattttaaagtgactcttaggttttaaaacgaaa
attcttattcttgagtaactctttcctgtaggtcaggttgctttctcaggtatagcatgaggtcgctcttattgaccaca
cctctaccggCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCAC
ACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGC
TCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTT
GCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC
ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAG
GCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTtttccataggctccgcccccctgacgagcatcacaaaaatcgacg
ctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctc
ctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgc
tgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctg
cgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaaca
ggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggaca
gtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccac
cgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatct
tttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttc
acctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaacctgaggctatggcagggcc
tgccgccccgacgttggctgcgagccctgggccttcacccgaacttggggggtggggtggggaaaaggaagaaacgcggg
cgtattggccccaatggggtctcggtggggtatcgacagagtgccagccctgggaccgaaccccgcgtttatgaacaaac
gacccaacaccgtgcgttttattctgtctttttattgccgtcatagcgcgggttccttccggtattgtctccttccgtgt
ttcagttagcctccccctagggtgggcgaagaactccagcatgagatccccgcgctggaggatcatccagccggcgtccc
ggaaaacgattccgaagcccaacctttcatagaaggcggcggtggaatcgaaatctcgtgatggcaggttgggcgtcgct
tggtcggttcatttcgaaccccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatc
gggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagcca
acgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggccattttccaccatg
atattcggcaagcaggcatcgtcatgggtcacgacgagatcctcgccgtcgggcatgctcgccttgagcctggcgaacag
ttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctc
gctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagcc
atgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtc
ccttcccgcttcagtgacaacgtcgagcacagctgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcct
cgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgcccctgcgctgacagccggaac
acggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagcggccggagaacc
tgcgtgcaatccatcttgttcaatcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatga
gcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgaa
cgaagcatctgtgcttcattttgtagaacaaaaatgcaacgcgagagcgctaatttttcaaacaaagaatctgagctgca
tttttacagaacagaaatgcaacgcgaaagcgctattttaccaacgaagaatctgtgcttcatttttgtaaaacaaaaat
gcaacgcgagagcgctaatttttcaaacaaagaatctgagctgcatttttacagaacagaaatgcaacgcgagagcgcta
ttttaccaacaaagaatctatacttcttttttgttctacaaaaatgcatcccgagagcgctatttttctaacaaagcatc
ttagattactttttttctcctttgtgcgctctataatgcagtctcttgataactttttgcactgtaggtccgttaaggtt
agaagaaggctactttggtgtctattttctcttccataaaaaaagcctgactccacttcccgcgtttactgattactagc
gaagctgcgggtgcattttttcaagataaaggcatccccgattatattctataccgatgtggattgcgcatactttgtga
acagaaagtgatagcgttgatgattcttcattggtcagaaaattatgaacggtttcttctattttgtctctatatactac
gtataggaaatgtttacattttcgtattgttttcgattcactctatgaatagttcttactacaatttttttgtctaaaga
gtaatactagagataaacataaaaaatgtagaggtcgagtttagatgcaagttcaaggagcgaaaggtggatgggtaggt
tatatagggatatagcacagagatatatagcaaagagatacttttgagcaatgtttgtggaagcggtattcgcaatattt
tagtagctcgttacagtccggtgcgtttttggttttttgaaagtgcgtcttcagagcgcttttggttttcaaaagcgctc
tgaagttcctatactttctagagaataggaacttcggaataggaacttcaaagcgtttccgaaaacgagcgcttccgaaa
atgcaacgcgagctgcgcacatacagctcactgttcacgtcgcacctatatctgcgtgttgcctgtatatatatatacat
gagaagaacggcatagtgcgtgtttatgcttaaatgcgtacttatatgcgtctatttatgtaggatgaaaggtagtctag
tacctcctgtgatattatcccattccatgcggggtatcgtatgcttccttcagcactaccctttagctgttctatatgct
gccactcctcaattggattagtctcatccttcaatgctatcatttcctttgatattggatcatattaagaaaccattatt
atcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacct
ctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgt
cagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatagatca
acgacattactatatatataatataggaagcatttaatagaacagcatcgtaatatatgtgtactttgcagttatgacgc
cagatggcagtagtggaagatattctttattgaaaaatagcttgtcaccttacgtacaatcttgatccggagcttttctt
tttttgccgattaagaattaattcggtcgaaaaaagaaaaggagagggccaagagggagggcattggtgactattgagca
cgtgagtatacgtgattaagcacacaaaggcagcttggagtatgtctgttattaatttcacaggtagttctggtccattg
gtgaaagtttgcggcttgcagagcacagaggccgcagaatgtgctctagattccgatgctgacttgctgggtattatatg
tgtgcccaatagaaagagaacaattgacccggttattgcaaggaaaatttcaagtcttgtaaaagcatataaaaatagtt
caggcactccgaaatacttggttggcgtgtttcgtaatcaacctaaggaggatgttttggctctggtcaatgattacggc
attgatatcgtccaactgcatggagatgagtcgtggcaagaataccaagagttcctcggtttgccagttattaaaagact
cgtatttccaaaagactgcaacatactactcagtgcagcttcacagaaacctcattcgtttattcccttgtttgattcag
aagcaggtgggacaggtgaacttttggattggaactcgatttctgactgggttggaaggcaagagagccccgaaagctta
cattttatgttagctggtggactgacgccagaaaatgttggtgatgcgcttagattaaatggcgttattggtgttgatgt
aagcggaggtgtggagacaaatggtgtaaaagactctaacaaaatagcaaatttcgtcaaaaatgctaagaaataggtta
ttactgagtagtatttatttaagtattgtttgtgcacttgccgatctatgcggtgtgaaataccgcacagatgcgtaagg
agaaaataccgcatcaggaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattt
tttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagt
ttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccac
tacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccc
cgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggc
gctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtccattc
gccattcaggctgcgcaactgttgggaagggcgat
//

 

Caution 

Product is for research use only!
 

Search name

pGBKT7-53,Plasmid pGBKT7-53,pGBKT7-53 vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart