pGBKT7-lam

$216.00

  • Model: PVT4020
  • 50 Units in Stock
Ask a question


Add to Cart:

pGBKT7-lam

PVT4020     2ug
 

pGBKT7-lam Plasmind information

Promoter: T7, ADH1
Replicon: 2 ori, ori, FI ori
Classification: yeast plasmid series, yeast two hybrid vector
Plasmid size: 7.9kb
Prokaryotic resistance: Kan
Selection marker: TRP1
Clone strain: DH5 alpha
Culture conditions: 37 LB, aerobic
Host cells: yeast cells
Primers for 5'sequencing: T7:TAATACGACTCACTATAGGG
Primers for 3'sequencing: primers were designed according to the sequence

pGBKT7-lam plasmid description

  pGBKT7-Lam is a negative control plasmid that encodes a fusionof the human lamin C protein (a.a. 66–230) and the GAL4 DNA-BD (a.a. 1–147). The lamin C cDNA insert (GenBank Accession #M13451) was derived from the plasmid referenced in Bartel et al. (1993a). Plasmid modification was performed atBD Biosciences Clontech. Yeast cotransformed with pGBKT7-Lam and pGADT7-RecT, provide a measure of the backgroundthat is due to false-positive two-hybrid interactions. pGBKT7-Lam has not been sequenced.


Caution:
Product is for research use only!

 

Search name

pGBKT7-lam,Plasmid pGBKT7-lam,pGBKT7-lam vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart