pGEX- 5X- 2


  • Model: PVT0033
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGEX-5X-2,Plasmid pGEX-5X-2,pGEX-5X-2 vector


pGEX-5X-2 Information

Promoter: Tac/lac

Replicon: ColE1 ori

Plasmid classification: Escherichia coli vector; PGEX series expression plasmid

Plasmid size: 4973bp

Plasmid label: N-GST, N-Factor Xa

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pGEX5: GGGCTGGCAAGCCACGTTTGGTG

3'sequencing primers: pGEX3: CCGGGAGCTGCATGTGTCAGAGG

Note: the recombinant protein can be purified by GST affinity column

Use:pGEX Plasmid


pGEX-5X-2 Description



pGEX-5X-2 Sequence

LOCUS       Exported File           4973 bp ds-DNA    circular SYN 10-4-2015
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4973)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-4-10  
FEATURES             Location/Qualifiers
     source          1..4973
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    183..211
                     /note="tac promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac?UV5 promoters"
     protein_bind    219..235
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             258..911
                     /product="glutathione S-transferase from Schistosoma
     CDS             921..932
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     promoter        1276..1380
                     /note="AmpR promoter"
     CDS             1381..2241
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2412..3000
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     promoter        3244..3321
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3322..4404
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    4417..4438
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4453..4483
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4491..4507
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4515..4531
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     primer_bind     complement(4547..4563)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
        1 agcttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
       61 gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
      121 tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
      181 tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
      241 cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
      301 aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
      361 gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
      421 ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
      481 tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
      541 ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
      601 ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
      661 atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
      721 tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
      781 aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
      841 ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc
      901 atcctccaaa atcggatctg atcgaaggtc gtgggatccc cggaattccc gggtcgactc
      961 gagcggccgc atcgtgactg actgacgatc tgcctcgcgc gtttcggtga tgacggtgaa
     1021 aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg
     1081 agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg
     1141 acccagtcac gtagcgatag cggagtgtat aattcttgaa gacgaaaggg cctcgtgata
     1201 cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact
     1261 tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg
     1321 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
     1381 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct
     1441 gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
     1501 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc
     1561 gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc
     1621 cgtgttgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
     1681 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta
     1741 tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc
     1801 ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
     1861 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg
     1921 cctgcagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
     1981 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
     2041 tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct
     2101 cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac
     2161 acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
     2221 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat
     2281 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg
     2341 accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc
     2401 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa
     2461 ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag
     2521 gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
     2581 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta
     2641 ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag
     2701 ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg
     2761 gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg
     2821 cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
     2881 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
     2941 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa
     3001 aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg
     3061 ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
     3121 gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
     3181 gagcgcctga tgcggtattt tctccttacg catctgtgcg gtatttcaca ccgcataaat
     3241 tccgacacca tcgaatggtg caaaaccttt cgcggtatgg catgatagcg cccggaagag
     3301 agtcaattca gggtggtgaa tgtgaaacca gtaacgttat acgatgtcgc agagtatgcc
     3361 ggtgtctctt atcagaccgt ttcccgcgtg gtgaaccagg ccagccacgt ttctgcgaaa
     3421 acgcgggaaa aagtggaagc ggcgatggcg gagctgaatt acattcccaa ccgcgtggca
     3481 caacaactgg cgggcaaaca gtcgttgctg attggcgttg ccacctccag tctggccctg
     3541 cacgcgccgt cgcaaattgt cgcggcgatt aaatctcgcg ccgatcaact gggtgccagc
     3601 gtggtggtgt cgatggtaga acgaagcggc gtcgaagcct gtaaagcggc ggtgcacaat
     3661 cttctcgcgc aacgcgtcag tgggctgatc attaactatc cgctggatga ccaggatgcc
     3721 attgctgtgg aagctgcctg cactaatgtt ccggcgttat ttcttgatgt ctctgaccag
     3781 acacccatca acagtattat tttctcccat gaagacggta cgcgactggg cgtggagcat
     3841 ctggtcgcat tgggtcacca gcaaatcgcg ctgttagcgg gcccattaag ttctgtctcg
     3901 gcgcgtctgc gtctggctgg ctggcataaa tatctcactc gcaatcaaat tcagccgata
     3961 gcggaacggg aaggcgactg gagtgccatg tccggttttc aacaaaccat gcaaatgctg
     4021 aatgagggca tcgttcccac tgcgatgctg gttgccaacg atcagatggc gctgggcgca
     4081 atgcgcgcca ttaccgagtc cgggctgcgc gttggtgcgg atatctcggt agtgggatac
     4141 gacgataccg aagacagctc atgttatatc ccgccgttaa ccaccatcaa acaggatttt
     4201 cgcctgctgg ggcaaaccag cgtggaccgc ttgctgcaac tctctcaggg ccaggcggtg
     4261 aagggcaatc agctgttgcc cgtctcactg gtgaaaagaa aaaccaccct ggcgcccaat
     4321 acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc acgacaggtt
     4381 tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc tcactcatta
     4441 ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa ttgtgagcgg
     4501 ataacaattt cacacaggaa acagctatga ccatgattac ggattcactg gccgtcgttt
     4561 tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc
     4621 cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt
     4681 tgcgcagcct gaatggcgaa tggcgctttg cctggtttcc ggcaccagaa gcggtgccgg
     4741 aaagctggct ggagtgcgat cttcctgagg ccgatactgt cgtcgtcccc tcaaactggc
     4801 agatgcacgg ttacgatgcg cccatctaca ccaacgtaac ctatcccatt acggtcaatc
     4861 cgccgtttgt tcccacggag aatccgacgg gttgttactc gctcacattt aatgttgatg
     4921 aaagctggct acaggaaggc cagacgcgaa ttatttttga tggcgttgga att
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
