pGEX- 6P- 1

$166.00

  • Model: PVT0035
  • 50 Units in Stock
Ask a question


Add to Cart:

pGEX-6P-1

PVT0035    2ug
 

pGEX-6P-1 Information

Promoter: Tac/lac
Replicon: ColE1 ori
Plasmid classification: Escherichia coli vector; PGEX series expression plasmid
Plasmid size: 4984bp
Plasmid label: N-GST, N-PP/3C
Prokaryotic resistance: ampicillin Amp
Cloned strain: DH5 alpha
Culture conditions: 37 centigrade, aerobic, LB
Expression host: Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: pGEX5: GGGCTGGCAAGCCACGTTTGGTG
3'sequencing primers: pGEX3: CCGGGAGCTGCATGTGTCAGAGG
Note: the recombinant protein can be purified by GST affinity column
Use:pGEX Plasmid

 

pGEX-6P-1 Description

pGEX-6P-1-Plasmid

 

 

pGEX-6P-1 Sequence

LOCUS       pGEX-6P-1 4984 bp  DNA    circular  SYN
DEFINITION  pGEX-6P-1
FEATURES             Location/Qualifiers
     source          1..4984
                     /organism="pGEX-6P-1"
                     /mol_type="other DNA"
     promoter        184..212
                     /label="tac_promoter"
     misc_feature    224..246
                     /label="M13_pUC_rev_primer"
     gene            258..992
                     /label="GST"
                     /gene="GST"
     CDS             258..992
                     /label="ORF frame 3"
     misc_feature    918..938
                     /label="precision"
     misc_feature    complement(1034..1056)
                     /label="pGEX_3_primer"
     promoter        1322..1350
                     /label="AmpR_promoter"
     gene            1392..2252
                     /label="Ampicillin"
                     /gene="Ampicillin"
     CDS             1392..2252
                     /label="ORF frame 3"
     rep_origin      2407..3026
                     /label="pBR322_origin"
     misc_feature    3324..4415
                     /label="lacI"
     CDS             3456..4415
                     /label="ORF frame 3"
     promoter        4464..4493
                     /label="lac_promoter"
     misc_feature    4507..4529
                     /label="M13_pUC_rev_primer"
     promoter        4528..4546
                     /label="M13_reverse_primer"
     CDS             4538..81
                     /label="ORF frame 2"
     misc_feature    4555..4710
                     /label="lacZ_a"
     promoter        complement(4558..4574)
                     /label="M13_forward20_primer"
     misc_feature    complement(4567..4589)
                     /label="M13_pUC_fwd_primer"
ORIGIN
    1 ACGTTATCGA CTGCACGGTG CACCAATGCT TCTGGCGTCA GGCAGCCATC GGAAGCTGTG
   61 GTATGGCTGT GCAGGTCGTA AATCACTGCA TAATTCGTGT CGCTCAAGGC GCACTCCCGT
  121 TCTGGATAAT GTTTTTTGCG CCGACATCAT AACGGTTCTG GCAAATATTC TGAAATGAGC
  181 TGTTGACAAT TAATCATCGG CTCGTATAAT GTGTGGAATT GTGAGCGGAT AACAATTTCA
  241 CACAGGAAAC AGTATTCATG TCCCCTATAC TAGGTTATTG GAAAATTAAG GGCCTTGTGC
  301 AACCCACTCG ACTTCTTTTG GAATATCTTG AAGAAAAATA TGAAGAGCAT TTGTATGAGC
  361 GCGATGAAGG TGATAAATGG CGAAACAAAA AGTTTGAATT GGGTTTGGAG TTTCCCAATC
  421 TTCCTTATTA TATTGATGGT GATGTTAAAT TAACACAGTC TATGGCCATC ATACGTTATA
  481 TAGCTGACAA GCACAACATG TTGGGTGGTT GTCCAAAAGA GCGTGCAGAG ATTTCAATGC
  541 TTGAAGGAGC GGTTTTGGAT ATTAGATACG GTGTTTCGAG AATTGCATAT AGTAAAGACT
  601 TTGAAACTCT CAAAGTTGAT TTTCTTAGCA AGCTACCTGA AATGCTGAAA ATGTTCGAAG
  661 ATCGTTTATG TCATAAAACA TATTTAAATG GTGATCATGT AACCCATCCT GACTTCATGT
  721 TGTATGACGC TCTTGATGTT GTTTTATACA TGGACCCAAT GTGCCTGGAT GCGTTCCCAA
  781 AATTAGTTTG TTTTAAAAAA CGTATTGAAG CTATCCCACA AATTGATAAG TACTTGAAAT
  841 CCAGCAAGTA TATAGCATGG CCTTTGCAGG GCTGGCAAGC CACGTTTGGT GGTGGCGACC
  901 ATCCTCCAAA ATCGGATCTG GAAGTTCTGT TCCAGGGGCC CCTGGGATCC CCGGAATTCC
  961 CGGGTCGACT CGAGCGGCCG CATCGTGACT GACTGACGAT CTGCCTCGCG CGTTTCGGTG
1021 ATGACGGTGA AAACCTCTGA CACATGCAGC TCCCGGAGAC GGTCACAGCT TGTCTGTAAG
1081 CGGATGCCGG GAGCAGACAA GCCCGTCAGG GCGCGTCAGC GGGTGTTGGC GGGTGTCGGG
1141 GCGCAGCCAT GACCCAGTCA CGTAGCGATA GCGGAGTGTA TAATTCTTGA AGACGAAAGG
1201 GCCTCGTGAT ACGCCTATTT TTATAGGTTA ATGTCATGAT AATAATGGTT TCTTAGACGT
1261 CAGGTGGCAC TTTTCGGGGA AATGTGCGCG GAACCCCTAT TTGTTTATTT TTCTAAATAC
1321 ATTCAAATAT GTATCCGCTC ATGAGACAAT AACCCTGATA AATGCTTCAA TAATATTGAA
1381 AAAGGAAGAG TATGAGTATT CAACATTTCC GTGTCGCCCT TATTCCCTTT TTTGCGGCAT
1441 TTTGCCTTCC TGTTTTTGCT CACCCAGAAA CGCTGGTGAA AGTAAAAGAT GCTGAAGATC
1501 AGTTGGGTGC ACGAGTGGGT TACATCGAAC TGGATCTCAA CAGCGGTAAG ATCCTTGAGA
1561 GTTTTCGCCC CGAAGAACGT TTTCCAATGA TGAGCACTTT TAAAGTTCTG CTATGTGGCG
1621 CGGTATTATC CCGTGTTGAC GCCGGGCAAG AGCAACTCGG TCGCCGCATA CACTATTCTC
1681 AGAATGACTT GGTTGAGTAC TCACCAGTCA CAGAAAAGCA TCTTACGGAT GGCATGACAG
1741 TAAGAGAATT ATGCAGTGCT GCCATAACCA TGAGTGATAA CACTGCGGCC AACTTACTTC
1801 TGACAACGAT CGGAGGACCG AAGGAGCTAA CCGCTTTTTT GCACAACATG GGGGATCATG
1861 TAACTCGCCT TGATCGTTGG GAACCGGAGC TGAATGAAGC CATACCAAAC GACGAGCGTG
1921 ACACCACGAT GCCTGCAGCA ATGGCAACAA CGTTGCGCAA ACTATTAACT GGCGAACTAC
1981 TTACTCTAGC TTCCCGGCAA CAATTAATAG ACTGGATGGA GGCGGATAAA GTTGCAGGAC
2041 CACTTCTGCG CTCGGCCCTT CCGGCTGGCT GGTTTATTGC TGATAAATCT GGAGCCGGTG
2101 AGCGTGGGTC TCGCGGTATC ATTGCAGCAC TGGGGCCAGA TGGTAAGCCC TCCCGTATCG
2161 TAGTTATCTA CACGACGGGG AGTCAGGCAA CTATGGATGA ACGAAATAGA CAGATCGCTG
2221 AGATAGGTGC CTCACTGATT AAGCATTGGT AACTGTCAGA CCAAGTTTAC TCATATATAC
2281 TTTAGATTGA TTTAAAACTT CATTTTTAAT TTAAAAGGAT CTAGGTGAAG ATCCTTTTTG
2341 ATAATCTCAT GACCAAAATC CCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCCG
2401 TAGAAAAGAT CAAAGGATCT TCTTGAGATC CTTTTTTTCT GCGCGTAATC TGCTGCTTGC
2461 AAACAAAAAA ACCACCGCTA CCAGCGGTGG TTTGTTTGCC GGATCAAGAG CTACCAACTC
2521 TTTTTCCGAA GGTAACTGGC TTCAGCAGAG CGCAGATACC AAATACTGTC CTTCTAGTGT
2581 AGCCGTAGTT AGGCCACCAC TTCAAGAACT CTGTAGCACC GCCTACATAC CTCGCTCTGC
2641 TAATCCTGTT ACCAGTGGCT GCTGCCAGTG GCGATAAGTC GTGTCTTACC GGGTTGGACT
2701 CAAGACGATA GTTACCGGAT AAGGCGCAGC GGTCGGGCTG AACGGGGGGT TCGTGCACAC
2761 AGCCCAGCTT GGAGCGAACG ACCTACACCG AACTGAGATA CCTACAGCGT GAGCTATGAG
2821 AAAGCGCCAC GCTTCCCGAA GGGAGAAAGG CGGACAGGTA TCCGGTAAGC GGCAGGGTCG
2881 GAACAGGAGA GCGCACGAGG GAGCTTCCAG GGGGAAACGC CTGGTATCTT TATAGTCCTG
2941 TCGGGTTTCG CCACCTCTGA CTTGAGCGTC GATTTTTGTG ATGCTCGTCA GGGGGGCGGA
3001 GCCTATGGAA AAACGCCAGC AACGCGGCCT TTTTACGGTT CCTGGCCTTT TGCTGGCCTT
3061 TTGCTCACAT GTTCTTTCCT GCGTTATCCC CTGATTCTGT GGATAACCGT ATTACCGCCT
3121 TTGAGTGAGC TGATACCGCT CGCCGCAGCC GAACGACCGA GCGCAGCGAG TCAGTGAGCG
3181 AGGAAGCGGA AGAGCGCCTG ATGCGGTATT TTCTCCTTAC GCATCTGTGC GGTATTTCAC
3241 ACCGCATAAA TTCCGACACC ATCGAATGGT GCAAAACCTT TCGCGGTATG GCATGATAGC
3301 GCCCGGAAGA GAGTCAATTC AGGGTGGTGA ATGTGAAACC AGTAACGTTA TACGATGTCG
3361 CAGAGTATGC CGGTGTCTCT TATCAGACCG TTTCCCGCGT GGTGAACCAG GCCAGCCACG
3421 TTTCTGCGAA AACGCGGGAA AAAGTGGAAG CGGCGATGGC GGAGCTGAAT TACATTCCCA
3481 ACCGCGTGGC ACAACAACTG GCGGGCAAAC AGTCGTTGCT GATTGGCGTT GCCACCTCCA
3541 GTCTGGCCCT GCACGCGCCG TCGCAAATTG TCGCGGCGAT TAAATCTCGC GCCGATCAAC
3601 TGGGTGCCAG CGTGGTGGTG TCGATGGTAG AACGAAGCGG CGTCGAAGCC TGTAAAGCGG
3661 CGGTGCACAA TCTTCTCGCG CAACGCGTCA GTGGGCTGAT CATTAACTAT CCGCTGGATG
3721 ACCAGGATGC CATTGCTGTG GAAGCTGCCT GCACTAATGT TCCGGCGTTA TTTCTTGATG
3781 TCTCTGACCA GACACCCATC AACAGTATTA TTTTCTCCCA TGAAGACGGT ACGCGACTGG
3841 GCGTGGAGCA TCTGGTCGCA TTGGGTCACC AGCAAATCGC GCTGTTAGCG GGCCCATTAA
3901 GTTCTGTCTC GGCGCGTCTG CGTCTGGCTG GCTGGCATAA ATATCTCACT CGCAATCAAA
3961 TTCAGCCGAT AGCGGAACGG GAAGGCGACT GGAGTGCCAT GTCCGGTTTT CAACAAACCA
4021 TGCAAATGCT GAATGAGGGC ATCGTTCCCA CTGCGATGCT GGTTGCCAAC GATCAGATGG
4081 CGCTGGGCGC AATGCGCGCC ATTACCGAGT CCGGGCTGCG CGTTGGTGCG GATATCTCGG
4141 TAGTGGGATA CGACGATACC GAAGACAGCT CATGTTATAT CCCGCCGTCA ACCACCATCA
4201 AACAGGATTT TCGCCTGCTG GGGCAAACCA GCGTGGACCG CTTGCTGCAA CTCTCTCAGG
4261 GCCAGGCGGT GAAGGGCAAT CAGCTGTTGC CCGTCTCACT GGTGAAAAGA AAAACCACCC
4321 TGGCGCCCAA TACGCAAACC GCCTCTCCCC GCGCGTTGGC CGATTCATTA ATGCAGCTGG
4381 CACGACAGGT TTCCCGACTG GAAAGCGGGC AGTGAGCGCA ACGCAATTAA TGTGAGTTAG
4441 CTCACTCATT AGGCACCCCA GGCTTTACAC TTTATGCTTC CGGCTCGTAT GTTGTGTGGA
4501 ATTGTGAGCG GATAACAATT TCACACAGGA AACAGCTATG ACCATGATTA CGGATTCACT
4561 GGCCGTCGTT TTACAACGTC GTGACTGGGA AAACCCTGGC GTTACCCAAC TTAATCGCCT
4621 TGCAGCACAT CCCCCTTTCG CCAGCTGGCG TAATAGCGAA GAGGCCCGCA CCGATCGCCC
4681 TTCCCAACAG TTGCGCAGCC TGAATGGCGA ATGGCGCTTT GCCTGGTTTC CGGCACCAGA
4741 AGCGGTGCCG GAAAGCTGGC TGGAGTGCGA TCTTCCTGAG GCCGATACTG TCGTCGTCCC
4801 CTCAAACTGG CAGATGCACG GTTACGATGC GCCCATCTAC ACCAACGTAA CCTATCCCAT
4861 TACGGTCAAT CCGCCGTTTG TTCCCACGGA GAATCCGACG GGTTGTTACT CGCTCACATT
4921 TAATGTTGAT GAAAGCTGGC TACAGGAAGG CCAGACGCGA ATTATTTTTG ATGGCGTTGG
4981 AATT
//

 

Caution:
Product is for research use only!

 

Search name

pGEX-6P-1,Plasmid pGEX-6P-1,pGEX-6P-1 vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart