pGEX- 6P- 2

$136.00

  • Model: PVT0036
  • 50 Units in Stock
Ask a question


Add to Cart:

pGEX-6P-2

PVT0036 2ug
 

pGEX-6P-2 Information

Promoter: Tac/lac

Replicon: ColE1 ori

Plasmid classification: Escherichia coli vector; PGEX series expression plasmid

Plasmid size: 4985bp

Plasmid label: N-GST, N-PP/3C

Prokaryotic resistance: ampicillin

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pGEX5: GGGCTGGCAAGCCACGTTTGGTG

3'sequencing primers: pGEX3: CCGGGAGCTGCATGTGTCAGAGG

Note: the recombinant protein can be purified by GST affinity column

Use:pGEX Plasmid

 

pGEX-6P-2 Description

There are a range of Gluthatione Sepharose™ prepacked column and bulk media products available to purify GST Fusion proteins. For manual purification of sample volumes up to 600 µl use GST SpinTrap™ microspin columns or GST MultiTrap™ 4B 96-well plates. For sample volumes between 600 µl and 10 ml use GST GraviTrap™ gravity flow column. Where sample volumes are above 10 ml, use LabMate™ reservoir together with GST GraviTrap. All formats described can be used for preparation of samples in parallel. In addition GST HiTrap™ 1 and 5 ml columns and GST HiPrep™ FF 16/10 column are available for purification in a chromatography system such as the ÄKTA™ design system. Alternatively, Gluthatione Sepharose bulk media are available from 10 ml up to 500 ml. A GST Bulk Kit is also available combining 10 ml Gluthatione Sepharose 4B bulk medium and 5 empty columns with required buffers. For simplified buffer preparation use the GST Buffer Kit. Ordering information for all associated products is listed below.

pGEX-6P-2-vector

 

pGEX-6P-2 Sequence
LOCUS       pGEX-6P-2 4985 bp  DNA   circular SYN
DEFINITION  pGEX-6P-2
ACCESSION  
KEYWORDS   
SOURCE     
  ORGANISM  other sequences; artificial sequences; vectors.
COMMENT     This file is created by Vector NTI
         
FEATURES             Location/Qualifiers
     source          1..4985
                     /organism="pGEX-6P-2"
                     /mol_type="other DNA"
     promoter        184..212
                     /label="tac_promoter"
     misc_feature    224..246
                     /label="M13_pUC_rev_primer"
     gene            258..993
                     /label="GST"
                     /gene="GST"
     CDS             258..989
                     /label="ORF frame 3"
     misc_feature    918..938
                     /label="precision"
     misc_feature    complement(1035..1057)
                     /label="pGEX_3_primer"
     promoter        1323..1351
                     /label="AmpR_promoter"
     gene            1393..2253
                     /label="Ampicillin"
                     /gene="Ampicillin"
     CDS             1393..2253
                     /label="ORF frame 1"
     rep_origin      2408..3027
                     /label="pBR322_origin"
     misc_feature    3325..4416
                     /label="lacI"
     CDS             3457..4416
                     /label="ORF frame 1"
     promoter        4465..4494
                     /label="lac_promoter"
     misc_feature    4508..4530
                     /label="M13_pUC_rev_primer"
     promoter        4529..4547
                     /label="M13_reverse_primer"
     CDS             4539..81
                     /label="ORF frame 3"
     misc_feature    4556..4711
                     /label="lacZ_a"
     promoter        complement(4559..4575)
                     /label="M13_forward20_primer"
     misc_feature    complement(4568..4590)
                     /label="M13_pUC_fwd_primer"
ORIGIN
    1 ACGTTATCGA CTGCACGGTG CACCAATGCT TCTGGCGTCA GGCAGCCATC GGAAGCTGTG
   61 GTATGGCTGT GCAGGTCGTA AATCACTGCA TAATTCGTGT CGCTCAAGGC GCACTCCCGT
  121 TCTGGATAAT GTTTTTTGCG CCGACATCAT AACGGTTCTG GCAAATATTC TGAAATGAGC
  181 TGTTGACAAT TAATCATCGG CTCGTATAAT GTGTGGAATT GTGAGCGGAT AACAATTTCA
  241 CACAGGAAAC AGTATTCATG TCCCCTATAC TAGGTTATTG GAAAATTAAG GGCCTTGTGC
  301 AACCCACTCG ACTTCTTTTG GAATATCTTG AAGAAAAATA TGAAGAGCAT TTGTATGAGC
  361 GCGATGAAGG TGATAAATGG CGAAACAAAA AGTTTGAATT GGGTTTGGAG TTTCCCAATC
  421 TTCCTTATTA TATTGATGGT GATGTTAAAT TAACACAGTC TATGGCCATC ATACGTTATA
  481 TAGCTGACAA GCACAACATG TTGGGTGGTT GTCCAAAAGA GCGTGCAGAG ATTTCAATGC
  541 TTGAAGGAGC GGTTTTGGAT ATTAGATACG GTGTTTCGAG AATTGCATAT AGTAAAGACT
  601 TTGAAACTCT CAAAGTTGAT TTTCTTAGCA AGCTACCTGA AATGCTGAAA ATGTTCGAAG
  661 ATCGTTTATG TCATAAAACA TATTTAAATG GTGATCATGT AACCCATCCT GACTTCATGT
  721 TGTATGACGC TCTTGATGTT GTTTTATACA TGGACCCAAT GTGCCTGGAT GCGTTCCCAA
  781 AATTAGTTTG TTTTAAAAAA CGTATTGAAG CTATCCCACA AATTGATAAG TACTTGAAAT
  841 CCAGCAAGTA TATAGCATGG CCTTTGCAGG GCTGGCAAGC CACGTTTGGT GGTGGCGACC
  901 ATCCTCCAAA ATCGGATCTG GAAGTTCTGT TCCAGGGGCC CCTGGGATCC CCAGGAATTC
  961 CCGGGTCGAC TCGAGCGGCC GCATCGTGAC TGACTGACGA TCTGCCTCGC GCGTTTCGGT
1021 GATGACGGTG AAAACCTCTG ACACATGCAG CTCCCGGAGA CGGTCACAGC TTGTCTGTAA
1081 GCGGATGCCG GGAGCAGACA AGCCCGTCAG GGCGCGTCAG CGGGTGTTGG CGGGTGTCGG
1141 GGCGCAGCCA TGACCCAGTC ACGTAGCGAT AGCGGAGTGT ATAATTCTTG AAGACGAAAG
1201 GGCCTCGTGA TACGCCTATT TTTATAGGTT AATGTCATGA TAATAATGGT TTCTTAGACG
1261 TCAGGTGGCA CTTTTCGGGG AAATGTGCGC GGAACCCCTA TTTGTTTATT TTTCTAAATA
1321 CATTCAAATA TGTATCCGCT CATGAGACAA TAACCCTGAT AAATGCTTCA ATAATATTGA
1381 AAAAGGAAGA GTATGAGTAT TCAACATTTC CGTGTCGCCC TTATTCCCTT TTTTGCGGCA
1441 TTTTGCCTTC CTGTTTTTGC TCACCCAGAA ACGCTGGTGA AAGTAAAAGA TGCTGAAGAT
1501 CAGTTGGGTG CACGAGTGGG TTACATCGAA CTGGATCTCA ACAGCGGTAA GATCCTTGAG
1561 AGTTTTCGCC CCGAAGAACG TTTTCCAATG ATGAGCACTT TTAAAGTTCT GCTATGTGGC
1621 GCGGTATTAT CCCGTGTTGA CGCCGGGCAA GAGCAACTCG GTCGCCGCAT ACACTATTCT
1681 CAGAATGACT TGGTTGAGTA CTCACCAGTC ACAGAAAAGC ATCTTACGGA TGGCATGACA
1741 GTAAGAGAAT TATGCAGTGC TGCCATAACC ATGAGTGATA ACACTGCGGC CAACTTACTT
1801 CTGACAACGA TCGGAGGACC GAAGGAGCTA ACCGCTTTTT TGCACAACAT GGGGGATCAT
1861 GTAACTCGCC TTGATCGTTG GGAACCGGAG CTGAATGAAG CCATACCAAA CGACGAGCGT
1921 GACACCACGA TGCCTGCAGC AATGGCAACA ACGTTGCGCA AACTATTAAC TGGCGAACTA
1981 CTTACTCTAG CTTCCCGGCA ACAATTAATA GACTGGATGG AGGCGGATAA AGTTGCAGGA
2041 CCACTTCTGC GCTCGGCCCT TCCGGCTGGC TGGTTTATTG CTGATAAATC TGGAGCCGGT
2101 GAGCGTGGGT CTCGCGGTAT CATTGCAGCA CTGGGGCCAG ATGGTAAGCC CTCCCGTATC
2161 GTAGTTATCT ACACGACGGG GAGTCAGGCA ACTATGGATG AACGAAATAG ACAGATCGCT
2221 GAGATAGGTG CCTCACTGAT TAAGCATTGG TAACTGTCAG ACCAAGTTTA CTCATATATA
2281 CTTTAGATTG ATTTAAAACT TCATTTTTAA TTTAAAAGGA TCTAGGTGAA GATCCTTTTT
2341 GATAATCTCA TGACCAAAAT CCCTTAACGT GAGTTTTCGT TCCACTGAGC GTCAGACCCC
2401 GTAGAAAAGA TCAAAGGATC TTCTTGAGAT CCTTTTTTTC TGCGCGTAAT CTGCTGCTTG
2461 CAAACAAAAA AACCACCGCT ACCAGCGGTG GTTTGTTTGC CGGATCAAGA GCTACCAACT
2521 CTTTTTCCGA AGGTAACTGG CTTCAGCAGA GCGCAGATAC CAAATACTGT CCTTCTAGTG
2581 TAGCCGTAGT TAGGCCACCA CTTCAAGAAC TCTGTAGCAC CGCCTACATA CCTCGCTCTG
2641 CTAATCCTGT TACCAGTGGC TGCTGCCAGT GGCGATAAGT CGTGTCTTAC CGGGTTGGAC
2701 TCAAGACGAT AGTTACCGGA TAAGGCGCAG CGGTCGGGCT GAACGGGGGG TTCGTGCACA
2761 CAGCCCAGCT TGGAGCGAAC GACCTACACC GAACTGAGAT ACCTACAGCG TGAGCTATGA
2821 GAAAGCGCCA CGCTTCCCGA AGGGAGAAAG GCGGACAGGT ATCCGGTAAG CGGCAGGGTC
2881 GGAACAGGAG AGCGCACGAG GGAGCTTCCA GGGGGAAACG CCTGGTATCT TTATAGTCCT
2941 GTCGGGTTTC GCCACCTCTG ACTTGAGCGT CGATTTTTGT GATGCTCGTC AGGGGGGCGG
3001 AGCCTATGGA AAAACGCCAG CAACGCGGCC TTTTTACGGT TCCTGGCCTT TTGCTGGCCT
3061 TTTGCTCACA TGTTCTTTCC TGCGTTATCC CCTGATTCTG TGGATAACCG TATTACCGCC
3121 TTTGAGTGAG CTGATACCGC TCGCCGCAGC CGAACGACCG AGCGCAGCGA GTCAGTGAGC
3181 GAGGAAGCGG AAGAGCGCCT GATGCGGTAT TTTCTCCTTA CGCATCTGTG CGGTATTTCA
3241 CACCGCATAA ATTCCGACAC CATCGAATGG TGCAAAACCT TTCGCGGTAT GGCATGATAG
3301 CGCCCGGAAG AGAGTCAATT CAGGGTGGTG AATGTGAAAC CAGTAACGTT ATACGATGTC
3361 GCAGAGTATG CCGGTGTCTC TTATCAGACC GTTTCCCGCG TGGTGAACCA GGCCAGCCAC
3421 GTTTCTGCGA AAACGCGGGA AAAAGTGGAA GCGGCGATGG CGGAGCTGAA TTACATTCCC
3481 AACCGCGTGG CACAACAACT GGCGGGCAAA CAGTCGTTGC TGATTGGCGT TGCCACCTCC
3541 AGTCTGGCCC TGCACGCGCC GTCGCAAATT GTCGCGGCGA TTAAATCTCG CGCCGATCAA
3601 CTGGGTGCCA GCGTGGTGGT GTCGATGGTA GAACGAAGCG GCGTCGAAGC CTGTAAAGCG
3661 GCGGTGCACA ATCTTCTCGC GCAACGCGTC AGTGGGCTGA TCATTAACTA TCCGCTGGAT
3721 GACCAGGATG CCATTGCTGT GGAAGCTGCC TGCACTAATG TTCCGGCGTT ATTTCTTGAT
3781 GTCTCTGACC AGACACCCAT CAACAGTATT ATTTTCTCCC ATGAAGACGG TACGCGACTG
3841 GGCGTGGAGC ATCTGGTCGC ATTGGGTCAC CAGCAAATCG CGCTGTTAGC GGGCCCATTA
3901 AGTTCTGTCT CGGCGCGTCT GCGTCTGGCT GGCTGGCATA AATATCTCAC TCGCAATCAA
3961 ATTCAGCCGA TAGCGGAACG GGAAGGCGAC TGGAGTGCCA TGTCCGGTTT TCAACAAACC
4021 ATGCAAATGC TGAATGAGGG CATCGTTCCC ACTGCGATGC TGGTTGCCAA CGATCAGATG
4081 GCGCTGGGCG CAATGCGCGC CATTACCGAG TCCGGGCTGC GCGTTGGTGC GGATATCTCG
4141 GTAGTGGGAT ACGACGATAC CGAAGACAGC TCATGTTATA TCCCGCCGTC AACCACCATC
4201 AAACAGGATT TTCGCCTGCT GGGGCAAACC AGCGTGGACC GCTTGCTGCA ACTCTCTCAG
4261 GGCCAGGCGG TGAAGGGCAA TCAGCTGTTG CCCGTCTCAC TGGTGAAAAG AAAAACCACC
4321 CTGGCGCCCA ATACGCAAAC CGCCTCTCCC CGCGCGTTGG CCGATTCATT AATGCAGCTG
4381 GCACGACAGG TTTCCCGACT GGAAAGCGGG CAGTGAGCGC AACGCAATTA ATGTGAGTTA
4441 GCTCACTCAT TAGGCACCCC AGGCTTTACA CTTTATGCTT CCGGCTCGTA TGTTGTGTGG
4501 AATTGTGAGC GGATAACAAT TTCACACAGG AAACAGCTAT GACCATGATT ACGGATTCAC
4561 TGGCCGTCGT TTTACAACGT CGTGACTGGG AAAACCCTGG CGTTACCCAA CTTAATCGCC
4621 TTGCAGCACA TCCCCCTTTC GCCAGCTGGC GTAATAGCGA AGAGGCCCGC ACCGATCGCC
4681 CTTCCCAACA GTTGCGCAGC CTGAATGGCG AATGGCGCTT TGCCTGGTTT CCGGCACCAG
4741 AAGCGGTGCC GGAAAGCTGG CTGGAGTGCG ATCTTCCTGA GGCCGATACT GTCGTCGTCC
4801 CCTCAAACTG GCAGATGCAC GGTTACGATG CGCCCATCTA CACCAACGTA ACCTATCCCA
4861 TTACGGTCAA TCCGCCGTTT GTTCCCACGG AGAATCCGAC GGGTTGTTAC TCGCTCACAT
4921 TTAATGTTGA TGAAAGCTGG CTACAGGAAG GCCAGACGCG AATTATTTTT GATGGCGTTG
4981 GAATT
//

Caution:
Product is for research use only!


Search name

pGEX-6P-2,Plasmid pGEX-6P-2,pGEX-6P-2 vector

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart