

  • Model: PVT0029
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0029  2ug


pGEX-4T-1 information

Promoter: Tac/lac

Replicon: ColE1 ori

Plasmid classification: Escherichia coli vector; pGEX series expression plasmid

Plasmid size: 4969bp

Plasmid label: N-GST, N-thrombin

Prokaryotic resistance: ampicillin Amp

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pGEX5: GGGCTGGCAAGCCACGTTTGGTG

3'sequencing primers: pGEX3: CCGGGAGCTGCATGTGTCAGAGG

Note: the recombinant protein can be purified by GST affinity column

Use:pGEX Plasmid


pGEX-4T-1 Description

PGEX-4T-1 is a E.coli expression plasmid


pGEX-4T-1 Sequence

LOCUS       Exported                4969 bp ds-DNA     circular SYN 03-8-2015
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4969)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-8-3  
FEATURES             Location/Qualifiers
     source          1..4969
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    183..211
                     /note="tac promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac UV5 promoters"
     protein_bind    219..235
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             258..911
                     /product="glutathione S-transferase from Schistosoma
     CDS             918..935
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     promoter        1272..1376
                     /note="AmpR promoter"
     CDS             1377..2237
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2408..2996
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     promoter        3240..3317
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3318..4400
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    4413..4434
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4449..4479
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4487..4503
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4511..4527
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     CDS             4523..81
                     /gene="lacZ fragment"
                     /product="LacZ-alpha fragment of beta-galactosidase"
     primer_bind     complement(4543..4559)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
        1 acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
       61 gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
      121 tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
      181 tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
      241 cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
      301 aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
      361 gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
      421 ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
      481 tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
      541 ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
      601 ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
      661 atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
      721 tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
      781 aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
      841 ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc
      901 atcctccaaa atcggatctg gttccgcgtg gatccccgga attcccgggt cgactcgagc
      961 ggccgcatcg tgactgactg acgatctgcc tcgcgcgttt cggtgatgac ggtgaaaacc
     1021 tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca
     1081 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc
     1141 agtcacgtag cgatagcgga gtgtataatt cttgaagacg aaagggcctc gtgatacgcc
     1201 tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt ggcacttttc
     1261 ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc
     1321 cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga
     1381 gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt
     1441 ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag
     1501 tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag
     1561 aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgtg
     1621 ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg
     1681 agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca
     1741 gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag
     1801 gaccgaagga gctaaccgct tttttgcaca acatggggga tcatgtaact cgccttgatc
     1861 gttgggaacc ggagctgaat gaagccatac caaacgacga gcgtgacacc acgatgcctg
     1921 cagcaatggc aacaacgttg cgcaaactat taactggcga actacttact ctagcttccc
     1981 ggcaacaatt aatagactgg atggaggcgg ataaagttgc aggaccactt ctgcgctcgg
     2041 cccttccggc tggctggttt attgctgata aatctggagc cggtgagcgt gggtctcgcg
     2101 gtatcattgc agcactgggg ccagatggta agccctcccg tatcgtagtt atctacacga
     2161 cggggagtca ggcaactatg gatgaacgaa atagacagat cgctgagata ggtgcctcac
     2221 tgattaagca ttggtaactg tcagaccaag tttactcata tatactttag attgatttaa
     2281 aacttcattt ttaatttaaa aggatctagg tgaagatcct ttttgataat ctcatgacca
     2341 aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa aagatcaaag
     2401 gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca aaaaaaccac
     2461 cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt ccgaaggtaa
     2521 ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg tagttaggcc
     2581 accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag
     2641 tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac
     2701 cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc
     2761 gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc
     2821 ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca
     2881 cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc
     2941 tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg
     3001 ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct
     3061 ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata
     3121 ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc
     3181 gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc ataaattccg
     3241 acaccatcga atggtgcaaa acctttcgcg gtatggcatg atagcgcccg gaagagagtc
     3301 aattcagggt ggtgaatgtg aaaccagtaa cgttatacga tgtcgcagag tatgccggtg
     3361 tctcttatca gaccgtttcc cgcgtggtga accaggccag ccacgtttct gcgaaaacgc
     3421 gggaaaaagt ggaagcggcg atggcggagc tgaattacat tcccaaccgc gtggcacaac
     3481 aactggcggg caaacagtcg ttgctgattg gcgttgccac ctccagtctg gccctgcacg
     3541 cgccgtcgca aattgtcgcg gcgattaaat ctcgcgccga tcaactgggt gccagcgtgg
     3601 tggtgtcgat ggtagaacga agcggcgtcg aagcctgtaa agcggcggtg cacaatcttc
     3661 tcgcgcaacg cgtcagtggg ctgatcatta actatccgct ggatgaccag gatgccattg
     3721 ctgtggaagc tgcctgcact aatgttccgg cgttatttct tgatgtctct gaccagacac
     3781 ccatcaacag tattattttc tcccatgaag acggtacgcg actgggcgtg gagcatctgg
     3841 tcgcattggg tcaccagcaa atcgcgctgt tagcgggccc attaagttct gtctcggcgc
     3901 gtctgcgtct ggctggctgg cataaatatc tcactcgcaa tcaaattcag ccgatagcgg
     3961 aacgggaagg cgactggagt gccatgtccg gttttcaaca aaccatgcaa atgctgaatg
     4021 agggcatcgt tcccactgcg atgctggttg ccaacgatca gatggcgctg ggcgcaatgc
     4081 gcgccattac cgagtccggg ctgcgcgttg gtgcggatat ctcggtagtg ggatacgacg
     4141 ataccgaaga cagctcatgt tatatcccgc cgttaaccac catcaaacag gattttcgcc
     4201 tgctggggca aaccagcgtg gaccgcttgc tgcaactctc tcagggccag gcggtgaagg
     4261 gcaatcagct gttgcccgtc tcactggtga aaagaaaaac caccctggcg cccaatacgc
     4321 aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc
     4381 gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca
     4441 ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa
     4501 caatttcaca caggaaacag ctatgaccat gattacggat tcactggccg tcgttttaca
     4561 acgtcgtgac tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc
     4621 tttcgccagc tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg
     4681 cagcctgaat ggcgaatggc gctttgcctg gtttccggca ccagaagcgg tgccggaaag
     4741 ctggctggag tgcgatcttc ctgaggccga tactgtcgtc gtcccctcaa actggcagat
     4801 gcacggttac gatgcgccca tctacaccaa cgtaacctat cccattacgg tcaatccgcc
     4861 gtttgttccc acggagaatc cgacgggttg ttactcgctc acatttaatg ttgatgaaag
     4921 ctggctacag gaaggccaga cgcgaattat ttttgatggc gttggaatt

Product is for research use only!

Search name

pGEX-4T-1,Plasmid pGEX-4T-1,pGEX-4T-1 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
