pGEX-4T-3 Plasmid


  • Model: PVT0031
  • 50 Units in Stock
Ask a question

Add to Cart:

pGEX-4T-3 Plasmid

PVT0031   2ug


pGEX-4T-3 Plasmid Information

Alias: pgex4t3; pgex4t-3

TAC: promoter

Replicon: pBR322

Plasmid classification: Escherichia coli vector; pGEX series expression plasmid

Plasmid size: 4968 BP

Plasmid Tags: n-gst, n-thrombin

Prokaryotic resistance: amp

Clone strain: dh5a

Culture conditions: 37 degrees

Expression host: E.coli BL21 (DE3)

Culture conditions: 37 ℃, aerobic, lb

Induction method: IPTG or lactose and its analogues

5 'sequencing primer: pgex5: gggctggcaagccacgttgtggtg

3 'sequencing primer: pgex3: ccggaggtgcatgtcagagg

Note: GST affinity column can be used to purify recombinant protein

Plasmid host: Escherichia coli

Purpose of plasmid: protein expression

Fragment type: ORF

Fragment species: empty bodies

Prokaryotic resistance: amp


pGEX-4T-3 Plasmid Description

pGEX-4T-3 plasmid is a 4968 bp E.coli Expression Vector, which can be connected to the target gene through the enzyme cutting site at MCS, and tac promoter starts GST promoting labeling and target gene fusion expression.


pGEX-4T-3 Sequence

LOCUS       Exported File           4968 bp ds-DNA    circular SYN 28-1-2015
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4968)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-1-28 from SnapGene 2.0.1
FEATURES             Location/Qualifiers
     source          1..4968
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    183..211
                     /note="tac promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac?UV5 promoters"
     protein_bind    219..235
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             258..911
                     /product="glutathione S-transferase from Schistosoma
     CDS             918..935
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     promoter        1271..1375
                     /note="AmpR promoter"
     CDS             1376..2236
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2407..2995
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     promoter        3239..3316
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3317..4399
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    4412..4433
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4448..4478
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4486..4502
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4510..4526
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     primer_bind     complement(4542..4558)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
        1 acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
       61 gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
      121 tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
      181 tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
      241 cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
      301 aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
      361 gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
      421 ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
      481 tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
      541 ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
      601 ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
      661 atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
      721 tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
      781 aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
      841 ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc
      901 atcctccaaa atcggatctg gttccgcgtg gatccccgaa ttcccgggtc gactcgagcg
      961 gccgcatcgt gactgactga cgatctgcct cgcgcgtttc ggtgatgacg gtgaaaacct
     1021 ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag
     1081 acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggcgcag ccatgaccca
     1141 gtcacgtagc gatagcggag tgtataattc ttgaagacga aagggcctcg tgatacgcct
     1201 atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg
     1261 gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc
     1321 gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag
     1381 tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt
     1441 tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt
     1501 gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga
     1561 acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtgt
     1621 tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga
     1681 gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag
     1741 tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg
     1801 accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc gccttgatcg
     1861 ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgc
     1921 agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg
     1981 gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc
     2041 ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg ggtctcgcgg
     2101 tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac
     2161 ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact
     2221 gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa
     2281 acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa
     2341 aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg
     2401 atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc
     2461 gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac
     2521 tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca
     2581 ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt
     2641 ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc
     2701 ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg
     2761 aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc
     2821 cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac
     2881 gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct
     2941 ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc
     3001 cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt
     3061 tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac
     3121 cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg
     3181 cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca taaattccga
     3241 caccatcgaa tggtgcaaaa cctttcgcgg tatggcatga tagcgcccgg aagagagtca
     3301 attcagggtg gtgaatgtga aaccagtaac gttatacgat gtcgcagagt atgccggtgt
     3361 ctcttatcag accgtttccc gcgtggtgaa ccaggccagc cacgtttctg cgaaaacgcg
     3421 ggaaaaagtg gaagcggcga tggcggagct gaattacatt cccaaccgcg tggcacaaca
     3481 actggcgggc aaacagtcgt tgctgattgg cgttgccacc tccagtctgg ccctgcacgc
     3541 gccgtcgcaa attgtcgcgg cgattaaatc tcgcgccgat caactgggtg ccagcgtggt
     3601 ggtgtcgatg gtagaacgaa gcggcgtcga agcctgtaaa gcggcggtgc acaatcttct
     3661 cgcgcaacgc gtcagtgggc tgatcattaa ctatccgctg gatgaccagg atgccattgc
     3721 tgtggaagct gcctgcacta atgttccggc gttatttctt gatgtctctg accagacacc
     3781 catcaacagt attattttct cccatgaaga cggtacgcga ctgggcgtgg agcatctggt
     3841 cgcattgggt caccagcaaa tcgcgctgtt agcgggccca ttaagttctg tctcggcgcg
     3901 tctgcgtctg gctggctggc ataaatatct cactcgcaat caaattcagc cgatagcgga
     3961 acgggaaggc gactggagtg ccatgtccgg ttttcaacaa accatgcaaa tgctgaatga
     4021 gggcatcgtt cccactgcga tgctggttgc caacgatcag atggcgctgg gcgcaatgcg
     4081 cgccattacc gagtccgggc tgcgcgttgg tgcggatatc tcggtagtgg gatacgacga
     4141 taccgaagac agctcatgtt atatcccgcc gttaaccacc atcaaacagg attttcgcct
     4201 gctggggcaa accagcgtgg accgcttgct gcaactctct cagggccagg cggtgaaggg
     4261 caatcagctg ttgcccgtct cactggtgaa aagaaaaacc accctggcgc ccaatacgca
     4321 aaccgcctct ccccgcgcgt tggccgattc attaatgcag ctggcacgac aggtttcccg
     4381 actggaaagc gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact cattaggcac
     4441 cccaggcttt acactttatg cttccggctc gtatgttgtg tggaattgtg agcggataac
     4501 aatttcacac aggaaacagc tatgaccatg attacggatt cactggccgt cgttttacaa
     4561 cgtcgtgact gggaaaaccc tggcgttacc caacttaatc gccttgcagc acatccccct
     4621 ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc gcccttccca acagttgcgc
     4681 agcctgaatg gcgaatggcg ctttgcctgg tttccggcac cagaagcggt gccggaaagc
     4741 tggctggagt gcgatcttcc tgaggccgat actgtcgtcg tcccctcaaa ctggcagatg
     4801 cacggttacg atgcgcccat ctacaccaac gtaacctatc ccattacggt caatccgccg
     4861 tttgttccca cggagaatcc gacgggttgt tactcgctca catttaatgt tgatgaaagc
     4921 tggctacagg aaggccagac gcgaattatt tttgatggcg ttggaatt




Search name

pGEX-4T-3,Plasmid pGEX-4T-3,pGEX-4T-3 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
