

  • Model: PVT0032
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGEX-5X-1,Plasmid pGEX-5X-1,pGEX-5X-1 vector


pGEX-5X-1 Information

Promoter: Tac/lac

Replicon: ColE1 ori

Plasmid classification: Escherichia coli vector; PGEX series expression plasmid

Plasmid size: 4972bp

Plasmid label: N-GST, N-Factor Xa

Prokaryotic resistance: ampicillin Amp

Cloned strain: Escherichia coli DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pGEX5: GGGCTGGCAAGCCACGTTTGGTG

3'sequencing primers: pGEX3: CCGGGAGCTGCATGTGTCAGAGG

Note: the recombinant protein can be purified by GST affinity column


pGEX-5X-1 Sequence

LOCUS       Exported File           4972 bp ds-DNA    circular SYN 12-4-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4972)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-4-12  
FEATURES             Location/Qualifiers
     source          1..4972
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    183..211
                     /note="tac promoter"
                     /note="strong E. coli promoter; hybrid between the trp and
                     lac?UV5 promoters"
     protein_bind    219..235
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             258..911
                     /product="glutathione S-transferase from Schistosoma
     CDS             921..932
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     promoter        1275..1379
                     /note="AmpR promoter"
     CDS             1380..2240
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2411..2999
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     promoter        3243..3320
                     /gene="lacI (mutant)"
                     /note="lacIq promoter"
                     /note="In the lacIq allele, a single base change in the
                     promoter boosts expression of the lacI gene about 10-fold."
     CDS             3321..4403
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     protein_bind    4416..4437
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4452..4482
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4490..4506
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4514..4530
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     primer_bind     complement(4546..4562)
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
        1 agcttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg
       61 gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt
      121 tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc
      181 tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca
      241 cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc
      301 aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc
      361 gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc
      421 ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata
      481 tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc
      541 ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact
      601 ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag
      661 atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt
      721 tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa
      781 aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat
      841 ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc
      901 atcctccaaa atcggatctg atcgaaggtc gtgggatccc cgaattcccg ggtcgactcg
      961 agcggccgca tcgtgactga ctgacgatct gcctcgcgcg tttcggtgat gacggtgaaa
     1021 acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga
     1081 gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc gcagccatga
     1141 cccagtcacg tagcgatagc ggagtgtata attcttgaag acgaaagggc ctcgtgatac
     1201 gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca ggtggcactt
     1261 ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt
     1321 atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta
     1381 tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg
     1441 tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac
     1501 gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg
     1561 aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc
     1621 gtgttgacgc cgggcaagag caactcggtc gccgcataca ctattctcag aatgacttgg
     1681 ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta agagaattat
     1741 gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg acaacgatcg
     1801 gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta actcgccttg
     1861 atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac accacgatgc
     1921 ctgcagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt actctagctt
     1981 cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca cttctgcgct
     2041 cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag cgtgggtctc
     2101 gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta gttatctaca
     2161 cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag ataggtgcct
     2221 cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt tagattgatt
     2281 taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat aatctcatga
     2341 ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaaagatca
     2401 aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac
     2461 caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg
     2521 taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttag
     2581 gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac
     2641 cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt
     2701 taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg
     2761 agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc
     2821 ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc
     2881 gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc
     2941 acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa
     3001 acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt
     3061 tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt gagtgagctg
     3121 ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag gaagcggaag
     3181 agcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcataaatt
     3241 ccgacaccat cgaatggtgc aaaacctttc gcggtatggc atgatagcgc ccggaagaga
     3301 gtcaattcag ggtggtgaat gtgaaaccag taacgttata cgatgtcgca gagtatgccg
     3361 gtgtctctta tcagaccgtt tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa
     3421 cgcgggaaaa agtggaagcg gcgatggcgg agctgaatta cattcccaac cgcgtggcac
     3481 aacaactggc gggcaaacag tcgttgctga ttggcgttgc cacctccagt ctggccctgc
     3541 acgcgccgtc gcaaattgtc gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg
     3601 tggtggtgtc gatggtagaa cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc
     3661 ttctcgcgca acgcgtcagt gggctgatca ttaactatcc gctggatgac caggatgcca
     3721 ttgctgtgga agctgcctgc actaatgttc cggcgttatt tcttgatgtc tctgaccaga
     3781 cacccatcaa cagtattatt ttctcccatg aagacggtac gcgactgggc gtggagcatc
     3841 tggtcgcatt gggtcaccag caaatcgcgc tgttagcggg cccattaagt tctgtctcgg
     3901 cgcgtctgcg tctggctggc tggcataaat atctcactcg caatcaaatt cagccgatag
     3961 cggaacggga aggcgactgg agtgccatgt ccggttttca acaaaccatg caaatgctga
     4021 atgagggcat cgttcccact gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa
     4081 tgcgcgccat taccgagtcc gggctgcgcg ttggtgcgga tatctcggta gtgggatacg
     4141 acgataccga agacagctca tgttatatcc cgccgttaac caccatcaaa caggattttc
     4201 gcctgctggg gcaaaccagc gtggaccgct tgctgcaact ctctcagggc caggcggtga
     4261 agggcaatca gctgttgccc gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata
     4321 cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca cgacaggttt
     4381 cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct cactcattag
     4441 gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga
     4501 taacaatttc acacaggaaa cagctatgac catgattacg gattcactgg ccgtcgtttt
     4561 acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc
     4621 ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt
     4681 gcgcagcctg aatggcgaat ggcgctttgc ctggtttccg gcaccagaag cggtgccgga
     4741 aagctggctg gagtgcgatc ttcctgaggc cgatactgtc gtcgtcccct caaactggca
     4801 gatgcacggt tacgatgcgc ccatctacac caacgtaacc tatcccatta cggtcaatcc
     4861 gccgtttgtt cccacggaga atccgacggg ttgttactcg ctcacattta atgttgatga
     4921 aagctggcta caggaaggcc agacgcgaat tatttttgat ggcgttggaa tt


No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
