

  • Model: PVTY01087
  • 20 Units in Stock
Ask a question

Add to Cart:


PVTY01087  2ug

pGEX-6P-2 Description

Alias: pGEX-6P-2, pGEX6P2, pGEX 6P 2 Plasmid type: E.coli Expression Vector Copy number: High copy Promoter: Tac Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4985 bp 5' Sequencing primers and sequences: pGEX5':? GGGCTGGCAAGCCACGTTTGGTG 3' Sequencing primers and sequences: pGEX3': CCGGGAGCTGCATGTGTCAGAGG Tags: N-GST Resistance(s): Ampicillin (Amp) Note: The replicator is pMB1.

1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
