pGEX-6P-3

$280.00

  • Model: PVTY00840
  • 20 Units in Stock
Ask a question


Add to Cart:

pGEX-6P-3

PVTY00840  2ug

pGEX-6P-3 Description

Plasmid type: E.coli Expression Vector Copy number: High copy Promoter: Tac Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4983 bp 5' Sequencing primers and sequences: pGEX5':? GGGCTGGCAAGCCACGTTTGGTG 3' Sequencing primers and sequences: pGEX3': CCGGGAGCTGCATGTGTCAGAGG Tags: N-GST Resistance(s): Ampicillin (Amp) Note: The replicator is pMB1.

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart