pGL3- Enhancer Plasmid


  • Model: PVT1307
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGL3-Enhancer,Plasmid pGL3-Enhancer,pGL3-Enhancer vector



pGL3-Enhancer Information

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 5064bp

Prokaryotic resistance: Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: RVP3:CTAGCAAAATAGGCTGTCCC

Primers for 3'sequencing: primers designed based on sequences


pGL3-Enhancer Description

The pGL3 Luciferase Reporter Vectors(a–c) provide a basis for the quantitative analysis of factors that potentially regulate mammalian gene expression. These factors may be cis-acting, such as promoters and enhancers, or trans-acting, such as various DNA-binding factors. The backbone of the pGL3 Luciferase Reporter Vectors is designed for increased expression, and contains a modified coding region for firefly (Photinus pyralis) luciferase that has been optimized for monitoring transcriptional activity in transfected eukaryotic cells. The assay of this genetic reporter is rapid, sensitive and quantitative. In addition, these Luciferase Reporter Vectors contain numerous features aiding in the structural characterization of the putative regulatory sequences under investigation.


pGL3-Enhancer Multiple cloning site




pGL3-Enhancer Sequence

LOCUS       Exported File           5064 bp ds-DNA    circular SYN 23-3-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5064)
  TITLE     Direct Submission
  JOURNAL   Exported 2015-3-23 
FEATURES             Location/Qualifiers
     source          1..5064
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             88..1740
                     /product="firefly luciferase"
                     /note="enhanced?luc+ version of the luciferase gene"
     polyA_signal    1781..1902
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(2567..3155)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(3326..4186)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4187..4291)
                     /note="AmpR promoter"
     rep_origin      4318..4773
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     polyA_signal    4904..4952
                     /note="synthetic polyadenylation signal"
     misc_feature    4966..5057
                     /note="pause site"
                     /note="RNA polymerase II transcriptional pause signal from 
                     the human?alpha-2 globin gene"
        1 ggtaccgagc tcttacgcgt gctagcccgg gctcgagatc tgcgatctaa gtaagcttgg
       61 cattccggta ctgttggtaa agccaccatg gaagacgcca aaaacataaa gaaaggcccg
      121 gcgccattct atccgctgga agatggaacc gctggagagc aactgcataa ggctatgaag
      181 agatacgccc tggttcctgg aacaattgct tttacagatg cacatatcga ggtggacatc
      241 acttacgctg agtacttcga aatgtccgtt cggttggcag aagctatgaa acgatatggg
      301 ctgaatacaa atcacagaat cgtcgtatgc agtgaaaact ctcttcaatt ctttatgccg
      361 gtgttgggcg cgttatttat cggagttgca gttgcgcccg cgaacgacat ttataatgaa
      421 cgtgaattgc tcaacagtat gggcatttcg cagcctaccg tggtgttcgt ttccaaaaag
      481 gggttgcaaa aaattttgaa cgtgcaaaaa aagctcccaa tcatccaaaa aattattatc
      541 atggattcta aaacggatta ccagggattt cagtcgatgt acacgttcgt cacatctcat
      601 ctacctcccg gttttaatga atacgatttt gtgccagagt ccttcgatag ggacaagaca
      661 attgcactga tcatgaactc ctctggatct actggtctgc ctaaaggtgt cgctctgcct
      721 catagaactg cctgcgtgag attctcgcat gccagagatc ctatttttgg caatcaaatc
      781 attccggata ctgcgatttt aagtgttgtt ccattccatc acggttttgg aatgtttact
      841 acactcggat atttgatatg tggatttcga gtcgtcttaa tgtatagatt tgaagaagag
      901 ctgtttctga ggagccttca ggattacaag attcaaagtg cgctgctggt gccaacccta
      961 ttctccttct tcgccaaaag cactctgatt gacaaatacg atttatctaa tttacacgaa
     1021 attgcttctg gtggcgctcc cctctctaag gaagtcgggg aagcggttgc caagaggttc
     1081 catctgccag gtatcaggca aggatatggg ctcactgaga ctacatcagc tattctgatt
     1141 acacccgagg gggatgataa accgggcgcg gtcggtaaag ttgttccatt ttttgaagcg
     1201 aaggttgtgg atctggatac cgggaaaacg ctgggcgtta atcaaagagg cgaactgtgt
     1261 gtgagaggtc ctatgattat gtccggttat gtaaacaatc cggaagcgac caacgccttg
     1321 attgacaagg atggatggct acattctgga gacatagctt actgggacga agacgaacac
     1381 ttcttcatcg ttgaccgcct gaagtctctg attaagtaca aaggctatca ggtggctccc
     1441 gctgaattgg aatccatctt gctccaacac cccaacatct tcgacgcagg tgtcgcaggt
     1501 cttcccgacg atgacgccgg tgaacttccc gccgccgttg ttgttttgga gcacggaaag
     1561 acgatgacgg aaaaagagat cgtggattac gtcgccagtc aagtaacaac cgcgaaaaag
     1621 ttgcgcggag gagttgtgtt tgtggacgaa gtaccgaaag gtcttaccgg aaaactcgac
     1681 gcaagaaaaa tcagagagat cctcataaag gccaagaagg gcggaaagat cgccgtgtaa
     1741 ttctagagtc ggggcggccg gccgcttcga gcagacatga taagatacat tgatgagttt
     1801 ggacaaacca caactagaat gcagtgaaaa aaatgcttta tttgtgaaat ttgtgatgct
     1861 attgctttat ttgtaaccat tataagctgc aataaacaag ttaacaacaa caattgcatt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
