pGL3-Basic

$280.00

  • Model: PVTY00785
  • 20 Units in Stock
Ask a question


Add to Cart:

pGL3-Basic

PVTY00785  2ug

pGL3-Basic Description

Plasmid type: Promoter reporter vector Cloning Method: Multiple cloning sites,restriction endonuclease Size: 4818 bp 5' Sequencing primers and sequences: RVprimer3:?CTAGCAAAATAGGCTGTCCC Resistance(s): Ampicillin (Amp)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart