pGL4.13[luc2- SV40]

$215.00

  • Model: PVT10793
  • 50 Units in Stock
Ask a question


Add to Cart:

pGL4.13[luc2-SV40]


Catalog No. PVT10793
Packing 2ug

 

pGL4.13[luc2-SV40] Information
Function Mammal reporter plasmid
Resistance Amp
Screen /
Strain DH5alpha
Culture temperature 37degrees centigrade
Replicon pUC
Copy
Promoter SV40
Induction --
Forward primer RVP3:CTAGCAAAATAGGCTGTCCC
Reverse primer

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart