pGL4.19 Plasmid


  • Model: PVT1311
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pGL4.19,Plasmid pGL4.19,pGL4.19 vector


pGL4.19 Informaiton


Promoter: SV40

Replicon: pUC ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 5778bp

Prokaryotic resistance: Amp

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: Sv40-polyA-R:GAAATTTGTGATGCTATTGC

Primers for 3'sequencing: primers designed based on sequences


pGL4.19 Description

The pGL4.19[luc2CP/Neo] Vector encodes the luciferase reporter gene luc2CP (Photinus pyralis) and is designed for high expression and reduced anomalous transcription. This vector also contains a mammalian selectable marker for neomycin resistance in which the number of transcription factor binding sites has been reduced and mammalian codon usage optimized. This vector is engineered with fewer consensus regulatory sequences for reduced background and a decreased risk of anomolous transcription and has a synthetic reporter gene, which has been codon optimized for mammalian expression. The pGL4.19[luc2CP/Neo] Vector is a basic vector with no promoter. However, it contains a multiple cloning region that allows cloning of a promoter of choice. The luc2CP reporter gene contains two protein destabilization sequences, hCL1 and hPEST. The protein encoded by luc2CP responds more quickly and with greater magnitude to changes in transcriptional activity than the luc2 gene, its more stable counterpart.


pGL4.19 Multiple cloning site





pGL4.19 Sequence

LOCUS       Exported                5778 bp ds-DNA     circular SYN 03-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5778)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, September 3, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..5778
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             100..1749
                     /product="firefly luciferase"
                     /note="synthetic luc2 version of the luciferase gene"
     CDS             1756..1803
                     /product="non-ORF yeast peptide conferring 
                     ubiquitin-dependent degradation"
                     /note="human codon-optimized"
     CDS             1807..1926
                     /product="PEST degradation sequence from mouse ornithine 
                     /note="human codon-optimized"
     polyA_signal    1975..2096
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     promoter        2290..2647
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2498..2633
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2678..3472
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    3497..3545
                     /note="synthetic polyadenylation signal"
     rep_origin      complement(3872..4460)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(4660..5520)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     polyA_signal    5625..5673
                     /note="synthetic polyadenylation signal"
     misc_feature    5687..5778
                     /note="pause site"
                     /note="RNA polymerase II transcriptional pause signal from 
                     the human alpha-2 globin gene"
        1 ggcctaactg gccggtacct gagctcgcta gcctcgagga tatcaagatc tggcctcggc
       61 ggccaagctt ggcaatccgg tactgttggt aaagccacca tggaagatgc caaaaacatt
      121 aagaagggcc cagcgccatt ctacccactc gaagacggga ccgccggcga gcagctgcac
      181 aaagccatga agcgctacgc cctggtgccc ggcaccatcg cctttaccga cgcacatatc
      241 gaggtggaca ttacctacgc cgagtacttc gagatgagcg ttcggctggc agaagctatg
      301 aagcgctatg ggctgaatac aaaccatcgg atcgtggtgt gcagcgagaa tagcttgcag
      361 ttcttcatgc ccgtgttggg tgccctgttc atcggtgtgg ctgtggcccc agctaacgac
      421 atctacaacg agcgcgagct gctgaacagc atgggcatca gccagcccac cgtcgtattc
      481 gtgagcaaga aagggctgca aaagatcctc aacgtgcaaa agaagctacc gatcatacaa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
