pGL4.29[luc2P- CRE- Hygro]


  • Model: PVT10799
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT10799
Packing 2ug
Function Mammal reporter plasmid

Promoter: SV40

Replicon: PUC

Terminator: SV40 poly (a) signal

Plasmid classification: mammalian cells, signal pathway report vector

Plasmid size: 6084bp

Prokaryotic resistance: Amp

Filter marker: hyg

Clone strain: DH5a

Culture conditions: 37 degrees

Expression host: mammalian cells

Induction mode: transient expression without induction

5 'sequencing primer: rvp3: ctagcaaaataaggctgtccc

3 'sequencing primers: primers were designed according to the sequence

Plasmid host: mammalian cells

Plasmid usage: signal report

Fragment type: promoter

Fragment species: empty bodies

Prokaryotic resistance: Amp

Eukaryotic resistance: hyg

Fluorescent labeling: fluc


pGL4.29[luc2P/ CRE/ Hygro] Description

pGL4.29[luc2P/CRE/Hygro] Vector(a–f) contains a cAMP response element (CRE) that drives the transcription of the luciferase reporter gene luc2P (Photinus pyralis). luc2P is a synthetically-derived luciferase sequence with humanized codon optimization that is designed for high expression and reduced anomalous transcription. The luc2P gene contains hPEST, a protein destabilization sequence. The protein encoded by luc2P responds more quickly than the protein encoded by the luc2 gene upon induction. The vector backbone contains an ampicillin resistance gene to allow selection in E. coli and a mammalian selectable marker for hygromycin resistance.


pGL4.29[luc2P/ CRE/ Hygro] Sequence

LOCUS       Exported                6084 bp ds-DNA     circular SYN 04-SEP-2016

DEFINITION  Vector with a minimal promoter and a cAMP response element for 

            studying cell signaling using destabilized luciferase.



KEYWORDS    pGL4.29[luc2PCREHygro]

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 6084)

  AUTHORS   Promega

  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..6084

                     /organism="synthetic DNA construct"

                     /lab_host="Mammalian Cells"

                     /mol_type="other DNA"

     protein_bind    44..109

                     /bound_moiety="cAMP response element-binding protein CREB"


                     /note="cyclic AMP response element (3 copies)"

     promoter        151..182


                     /note="minimal TATA-box promoter with low basal activity"

     CDS             215..1864


                     /product="firefly luciferase"


                     /note="synthetic luc2 version of the luciferase gene"











     CDS             1868..1987


                     /product="PEST degradation sequence from mouse ornithine 



                     /note="human codon-optimized"


     polyA_signal    2039..2160

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     promoter        2354..2711

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     CDS             2742..3779


                     /product="hygromycin B phosphotransferase"


                     /note="confers resistance to hygromycin"








     polyA_signal    3803..3851

                     /note="synthetic polyadenylation signal"

     rep_origin      complement(4178..4766)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4966..5826)




                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     polyA_signal    5931..5979

                     /note="synthetic polyadenylation signal"

     misc_feature    5993..6084

                     /note="pause site"

                     /note="RNA polymerase II transcriptional pause signal from 

                     the human alpha-2 globin gene"


        1 ggcctaactg gccggtacct gagctcgcta gcgcaccaga cagtgacgtc agctgccaga

       61 tcccatggcc gtcatactgt gacgtctttc agacacccca ttgacgtcaa tgggagaaca

      121 gatctggcct cggcggccaa gcttagacac tagagggtat ataatggaag ctcgacttcc

      181 agcttggcaa tccggtactg ttggtaaagc caccatggaa gatgccaaaa acattaagaa

      241 gggcccagcg ccattctacc cactcgaaga cgggaccgcc ggcgagcagc tgcacaaagc

      301 catgaagcgc tacgccctgg tgcccggcac catcgccttt accgacgcac atatcgaggt

      361 ggacattacc tacgccgagt acttcgagat gagcgttcgg ctggcagaag ctatgaagcg

      421 ctatgggctg aatacaaacc atcggatcgt ggtgtgcagc gagaatagct tgcagttctt

      481 catgcccgtg ttgggtgccc tgttcatcgg tgtggctgtg gccccagcta acgacatcta

      541 caacgagcgc gagctgctga acagcatggg catcagccag cccaccgtcg tattcgtgag

      601 caagaaaggg ctgcaaaaga tcctcaacgt gcaaaagaag ctaccgatca tacaaaagat

      661 catcatcatg gatagcaaga ccgactacca gggcttccaa agcatgtaca ccttcgtgac

      721 ttcccatttg ccacccggct tcaacgagta cgacttcgtg cccgagagct tcgaccggga

      781 caaaaccatc gccctgatca tgaacagtag tggcagtacc ggattgccca agggcgtagc

      841 cctaccgcac cgcaccgctt gtgtccgatt cagtcatgcc cgcgacccca tcttcggcaa

      901 ccagatcatc cccgacaccg ctatcctcag cgtggtgcca tttcaccacg gcttcggcat

      961 gttcaccacg ctgggctact tgatctgcgg ctttcgggtc gtgctcatgt accgcttcga

     1021 ggaggagcta ttcttgcgca gcttgcaaga ctataagatt caatctgccc tgctggtgcc

     1081 cacactattt agcttcttcg ctaagagcac tctcatcgac aagtacgacc taagcaactt

     1141 gcacgagatc gccagcggcg gggcgccgct cagcaaggag gtaggtgagg ccgtggccaa

     1201 acgcttccac ctaccaggca tccgccaggg ctacggcctg acagaaacaa ccagcgccat

     1261 tctgatcacc cccgaagggg acgacaagcc tggcgcagta ggcaaggtgg tgcccttctt

     1321 cgaggctaag gtggtggact tggacaccgg taagacactg ggtgtgaacc agcgcggcga

     1381 gctgtgcgtc cgtggcccca tgatcatgag cggctacgtt aacaaccccg aggctacaaa

     1441 cgctctcatc gacaaggacg gctggctgca cagcggcgac atcgcctact gggacgagga

     1501 cgagcacttc ttcatcgtgg accggctgaa gagcctgatc aaatacaagg gctaccaggt

     1561 agccccagcc gaactggaga gcatcctgct gcaacacccc aacatcttcg acgccggggt

     1621 cgccggcctg cccgacgacg atgccggcga gctgcccgcc gcagtcgtcg tgctggaaca

     1681 cggtaaaacc atgaccgaga aggagatcgt ggactatgtg gccagccagg ttacaaccgc

     1741 caagaagctg cgcggtggtg ttgtgttcgt ggacgaggtg cctaaaggac tgaccggcaa

     1801 gttggacgcc cgcaagatcc gcgagattct cattaaggcc aagaagggcg gcaagatcgc

     1861 cgtgaattct cacggcttcc ctcccgaggt ggaggagcag gccgccggca ccctgcccat

     1921 gagctgcgcc caggagagcg gcatggatag acaccctgct gcttgcgcca gcgccaggat

     1981 caacgtctaa ggccgcgact ctagagtcgg ggcggccggc cgcttcgagc agacatgata

     2041 agatacattg atgagtttgg acaaaccaca actagaatgc agtgaaaaaa atgctttatt

     2101 tgtgaaattt gtgatgctat tgctttattt gtaaccatta taagctgcaa taaacaagtt

     2161 aacaacaaca attgcattca ttttatgttt caggttcagg gggaggtgtg ggaggttttt

     2221 taaagcaagt aaaacctcta caaatgtggt aaaatcgata aggatccgtt tgcgtattgg

     2281 gcgctcttcc gctgatctgc gcagcaccat ggcctgaaat aacctctgaa agaggaactt

     2341 ggttagctac cttctgaggc ggaaagaacc agctgtggaa tgtgtgtcag ttagggtgtg

     2401 gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag

     2461 caaccaggtg tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc

     2521 tcaattagtc agcaaccata gtcccgcccc taactccgcc catcccgccc ctaactccgc

     2581 ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg

     2641 aggccgcctc tgcctctgag ctattccaga agtagtgagg aggctttttt ggaggcctag

     2701 gcttttgcaa aaagctcgat tcttctgaca ctagcgccac catgaagaag cccgaactca

     2761 ccgctaccag cgttgaaaaa tttctcatcg agaagttcga cagtgtgagc gacctgatgc

     2821 agttgtcgga gggcgaagag agccgagcct tcagcttcga tgtcggcgga cgcggctatg

     2881 tactgcgggt gaatagctgc gctgatggct tctacaaaga ccgctacgtg taccgccact

     2941 tcgccagcgc tgcactaccc atccccgaag tgttggacat cggcgagttc agcgagagcc

     3001 tgacatactg catcagtaga cgcgcccaag gcgttactct ccaagacctc cccgaaacag

     3061 agctgcctgc tgtgttacag cctgtcgccg aagctatgga tgctattgcc gccgccgacc

     3121 tcagtcaaac cagcggcttc ggcccattcg ggccccaagg catcggccag tacacaacct

     3181 ggcgggattt catttgcgcc attgctgatc cccatgtcta ccactggcag accgtgatgg

     3241 acgacaccgt gtccgccagc gtagctcaag ccctggacga actgatgctg tgggccgaag

     3301 actgtcccga ggtgcgccac ctcgtccatg ccgacttcgg cagcaacaac gtcctgaccg

     3361 acaacggccg catcaccgcc gtaatcgact ggtccgaagc tatgttcggg gacagtcagt

     3421 acgaggtggc caacatcttc ttctggcggc cctggctggc ttgcatggag cagcagactc

     3481 gctacttcga gcgccggcat cccgagctgg ccggcagccc tcgtctgcga gcctacatgc

     3541 tgcgcatcgg cctggatcag ctctaccaga gcctcgtgga cggcaacttc gacgatgctg

     3601 cctgggctca aggccgctgc gatgccatcg tccgcagcgg ggccggcacc gtcggtcgca

     3661 cacaaatcgc tcgccggagc gcagccgtat ggaccgacgg ctgcgtcgag gtgctggccg

     3721 acagcggcaa ccgccggccc agtacacgac cgcgcgctaa ggaggtaggt cgagtttaaa

     3781 ctctagaacc ggtcatggcc gcaataaaat atctttattt tcattacatc tgtgtgttgg

     3841 ttttttgtgt gttcgaacta gatgctgtcg accgatgccc ttgagagcct tcaacccagt

     3901 cagctccttc cggtgggcgc ggggcatgac tatcgtcgcc gcacttatga ctgtcttctt

     3961 tatcatgcaa ctcgtaggac aggtgccggc agcgctcttc cgcttcctcg ctcactgact

     4021 cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac

     4081 ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa

     4141 aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg

     4201 acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa

     4261 gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc

     4321 ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac

     4381 gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac

     4441 cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg

     4501 taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt

     4561 atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa

     4621 cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct

     4681 cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga

     4741 ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg

     4801 ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct

     4861 tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt

     4921 aaacttggtc tgacagcggc cgcaaatgct aaaccactgc agtggttacc agtgcttgat

     4981 cagtgaggca ccgatctcag cgatctgcct atttcgttcg tccatagtgg cctgactccc

     5041 cgtcgtgtag atcactacga ttcgtgaggg cttaccatca ggccccagcg cagcaatgat

     5101 gccgcgagag ccgcgttcac cggcccccga tttgtcagca atgaaccagc cagcagggag

     5161 ggccgagcga agaagtggtc ctgctacttt gtccgcctcc atccagtcta tgagctgctg

     5221 tcgtgatgct agagtaagaa gttcgccagt gagtagtttc cgaagagttg tggccattgc

     5281 tactggcatc gtggtatcac gctcgtcgtt cggtatggct tcgttcaact ctggttccca

     5341 gcggtcaagc cgggtcacat gatcacccat attatgaaga aatgcagtca gctccttagg

     5401 gcctccgatc gttgtcagaa gtaagttggc cgcggtgttg tcgctcatgg taatggcagc

     5461 actacacaat tctcttaccg tcatgccatc cgtaagatgc ttttccgtga ccggcgagta

     5521 ctcaaccaag tcgttttgtg agtagtgtat acggcgacca agctgctctt gcccggcgtc

     5581 tatacgggac aacaccgcgc cacatagcag tactttgaaa gtgctcatca tcgggaatcg

     5641 ttcttcgggg cggaaagact caaggatctt gccgctattg agatccagtt cgatatagcc

     5701 cactcttgca cccagttgat cttcagcatc ttttactttc accagcgttt cggggtgtgc

     5761 aaaaacaggc aagcaaaatg ccgcaaagaa gggaatgagt gcgacacgaa aatgttggat

     5821 gctcatactc gtcctttttc aatattattg aagcatttat cagggttact agtacgtctc

     5881 tcaaggataa gtaagtaata ttaaggtacg ggaggtattg gacaggccgc aataaaatat

     5941 ctttattttc attacatctg tgtgttggtt ttttgtgtga atcgatagta ctaacatacg

     6001 ctctccatca aaacaaaacg aaacaaaaca aactagcaaa ataggctgtc cccagtgcaa

     6061 gtgcaggtgc cagaacattt ctct


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
