pGL4.48[luc2P SBE Hygro]

$236.00

  • Model: PVT12363
  • 20 Units in Stock
Ask a question


Add to Cart:

pGL4.48[luc2P SBE Hygro]

PVT12363    2ug
 

 

pGL4.48[luc2P SBE Hygro] Search name

pGL4.48[luc2P SBE Hygro],pGL4.48[luc2P SBE Hygro] vector,pGL4.48[luc2P SBE Hygro] plasmid,pGL4.48[luc2P SBE Hygro] map

 

 

pGL4.48[luc2P SBE Hygro] Information

Bacterial Resistance(s):   Amp

Screening: Hyg 
Growth Strain(s): DH5 alpha
Growth Condition: LB/37 Centigrade

 

pGL4.48[luc2P SBE Hygro] Sequence

ACTCGTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTACTAGTACGTCTCTCAAGGATAAGTAAGTAATATTAAGG
TACGGGAGGTATTGGACAGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGAT
AGTACTAACATACGCTCTCCATCAAAACAAAACGAAACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAG
GTGCCAGAACATTTCTCTGGCCTAACTGGCCGGTACCTGAGCTCAGTATGTCTAGACTGAAGTATGTCTAGACTGAAGTA
TGTCTAGACTGACTCGAGGATATCAAGATCTGGCCTCGGCGGCCAAGCTTAGACACTAGAGGGTATATAATGGAAGCTCG
ACTTCCAGCTTGGCAATCCGGTACTGTTGGTAAAGCCACCATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGCGCCAT
TCTACCCACTCGAAGACGGGACCGCCGGCGAGCAGCTGCACAAAGCCATGAAGCGCTACGCCCTGGTGCCCGGCACCATC
GCCTTTACCGACGCACATATCGAGGTGGACATTACCTACGCCGAGTACTTCGAGATGAGCGTTCGGCTGGCAGAAGCTAT
GAAGCGCTATGGGCTGAATACAAACCATCGGATCGTGGTGTGCAGCGAGAATAGCTTGCAGTTCTTCATGCCCGTGTTGG
GTGCCCTGTTCATCGGTGTGGCTGTGGCCCCAGCTAACGACATCTACAACGAGCGCGAGCTGCTGAACAGCATGGGCATC
AGCCAGCCCACCGTCGTATTCGTGAGCAAGAAAGGGCTGCAAAAGATCCTCAACGTGCAAAAGAAGCTACCGATCATACA
AAAGATCATCATCATGGATAGCAAGACCGACTACCAGGGCTTCCAAAGCATGTACACCTTCGTGACTTCCCATTTGCCAC
CCGGCTTCAACGAGTACGACTTCGTGCCCGAGAGCTTCGACCGGGACAAAACCATCGCCCTGATCATGAACAGTAGTGGC
AGTACCGGATTGCCCAAGGGCGTAGCCCTACCGCACCGCACCGCTTGTGTCCGATTCAGTCATGCCCGCGACCCCATCTT
CGGCAACCAGATCATCCCCGACACCGCTATCCTCAGCGTGGTGCCATTTCACCACGGCTTCGGCATGTTCACCACGCTGG
GCTACTTGATCTGCGGCTTTCGGGTCGTGCTCATGTACCGCTTCGAGGAGGAGCTATTCTTGCGCAGCTTGCAAGACTAT
AAGATTCAATCTGCCCTGCTGGTGCCCACACTATTTAGCTTCTTCGCTAAGAGCACTCTCATCGACAAGTACGACCTAAG
CAACTTGCACGAGATCGCCAGCGGCGGGGCGCCGCTCAGCAAGGAGGTAGGTGAGGCCGTGGCCAAACGCTTCCACCTAC
CAGGCATCCGCCAGGGCTACGGCCTGACAGAAACAACCAGCGCCATTCTGATCACCCCCGAAGGGGACGACAAGCCTGGC
GCAGTAGGCAAGGTGGTGCCCTTCTTCGAGGCTAAGGTGGTGGACTTGGACACCGGTAAGACACTGGGTGTGAACCAGCG
CGGCGAGCTGTGCGTCCGTGGCCCCATGATCATGAGCGGCTACGTTAACAACCCCGAGGCTACAAACGCTCTCATCGACA
AGGACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGACGAGCACTTCTTCATCGTGGACCGGCTGAAGAGC
CTGATCAAATACAAGGGCTACCAGGTAGCCCCAGCCGAACTGGAGAGCATCCTGCTGCAACACCCCAACATCTTCGACGC
CGGGGTCGCCGGCCTGCCCGACGACGATGCCGGCGAGCTGCCCGCCGCAGTCGTCGTGCTGGAACACGGTAAAACCATGA
CCGAGAAGGAGATCGTGGACTATGTGGCCAGCCAGGTTACAACCGCCAAGAAGCTGCGCGGTGGTGTTGTGTTCGTGGAC
GAGGTGCCTAAAGGACTGACCGGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGCAA
GATCGCCGTGAATTCTCACGGCTTCCCTCCCGAGGTGGAGGAGCAGGCCGCCGGCACCCTGCCCATGAGCTGCGCCCAGG
AGAGCGGCATGGATAGACACCCTGCTGCTTGCGCCAGCGCCAGGATCAACGTCTAAGGCCGCGACTCTAGAGTCGGGGCG
GCCGGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGC
TTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTG
CATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTAAAA
TCGATAAGGATCCGTTTGCGTATTGGGCGCTCTTCCGCTGATCTGCGCAGCACCATGGCCTGAAATAACCTCTGAAAGAG
GAACTTGGTTAGCTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGC
TCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGC
AGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAA
CTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCC
TCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCGATTCTTCTGACACTAG
CGCCACCATGAAGAAGCCCGAACTCACCGCTACCAGCGTTGAAAAATTTCTCATCGAGAAGTTCGACAGTGTGAGCGACC
TGATGCAGTTGTCGGAGGGCGAAGAGAGCCGAGCCTTCAGCTTCGATGTCGGCGGACGCGGCTATGTACTGCGGGTGAAT
AGCTGCGCTGATGGCTTCTACAAAGACCGCTACGTGTACCGCCACTTCGCCAGCGCTGCACTACCCATCCCCGAAGTGTT
GGACATCGGCGAGTTCAGCGAGAGCCTGACATACTGCATCAGTAGACGCGCCCAAGGCGTTACTCTCCAAGACCTCCCCG
AAACAGAGCTGCCTGCTGTGTTACAGCCTGTCGCCGAAGCTATGGATGCTATTGCCGCCGCCGACCTCAGTCAAACCAGC
GGCTTCGGCCCATTCGGGCCCCAAGGCATCGGCCAGTACACAACCTGGCGGGATTTCATTTGCGCCATTGCTGATCCCCA
TGTCTACCACTGGCAGACCGTGATGGACGACACCGTGTCCGCCAGCGTAGCTCAAGCCCTGGACGAACTGATGCTGTGGG
CCGAAGACTGTCCCGAGGTGCGCCACCTCGTCCATGCCGACTTCGGCAGCAACAACGTCCTGACCGACAACGGCCGCATC
ACCGCCGTAATCGACTGGTCCGAAGCTATGTTCGGGGACAGTCAGTACGAGGTGGCCAACATCTTCTTCTGGCGGCCCTG
GCTGGCTTGCATGGAGCAGCAGACTCGCTACTTCGAGCGCCGGCATCCCGAGCTGGCCGGCAGCCCTCGTCTGCGAGCCT
ACATGCTGCGCATCGGCCTGGATCAGCTCTACCAGAGCCTCGTGGACGGCAACTTCGACGATGCTGCCTGGGCTCAAGGC
CGCTGCGATGCCATCGTCCGCAGCGGGGCCGGCACCGTCGGTCGCACACAAATCGCTCGCCGGAGCGCAGCCGTATGGAC
CGACGGCTGCGTCGAGGTGCTGGCCGACAGCGGCAACCGCCGGCCCAGTACACGACCGCGCGCTAAGGAGGTAGGTCGAG
TTTAAACTCTAGAACCGGTCATGGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTTGTGTGTTC
GAACTAGATGCTGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATC
GTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTTCCGCTTCCTCGCTCA
CTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAA
TCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGC
GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGAC
TATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTG
TCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG
CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA
ACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCT
ACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT
TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGC
AGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAA
AACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTT
TAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGCGGCCGCAAATGCTAAACCACTGCAGTGGTTACCAGTG
CTTGATCAGTGAGGCACCGATCTCAGCGATCTGCCTATTTCGTTCGTCCATAGTGGCCTGACTCCCCGTCGTGTAGATCA
CTACGATTCGTGAGGGCTTACCATCAGGCCCCAGCGCAGCAATGATGCCGCGAGAGCCGCGTTCACCGGCCCCCGATTTG
TCAGCAATGAACCAGCCAGCAGGGAGGGCCGAGCGAAGAAGTGGTCCTGCTACTTTGTCCGCCTCCATCCAGTCTATGAG
CTGCTGTCGTGATGCTAGAGTAAGAAGTTCGCCAGTGAGTAGTTTCCGAAGAGTTGTGGCCATTGCTACTGGCATCGTGG
TATCACGCTCGTCGTTCGGTATGGCTTCGTTCAACTCTGGTTCCCAGCGGTCAAGCCGGGTCACATGATCACCCATATTA
TGAAGAAATGCAGTCAGCTCCTTAGGGCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCGGTGTTGTCGCTCATGGTAAT
GGCAGCACTACACAATTCTCTTACCGTCATGCCATCCGTAAGATGCTTTTCCGTGACCGGCGAGTACTCAACCAAGTCGT
TTTGTGAGTAGTGTATACGGCGACCAAGCTGCTCTTGCCCGGCGTCTATACGGGACAACACCGCGCCACATAGCAGTACT
TTGAAAGTGCTCATCATCGGGAATCGTTCTTCGGGGCGGAAAGACTCAAGGATCTTGCCGCTATTGAGATCCAGTTCGAT
ATAGCCCACTCTTGCACCCAGTTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCGGGGTGTGCAAAAACAGGCAAGC
AAAATGCCGCAAAGAAGGGAATGAGTGCGACACGAAAATGTTGGATGCTCAT

 

Caution:
Product is for research use only!

 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart