pGL4.73[hRluc / SV40] Plasmid


  • Model: PVT1313
  • 49 Units in Stock
Ask a question

Add to Cart:

pGL4.73[hRluc / SV40]

Search name

pGL4.73[hRluc /SV40],Plasmid pGL4.73[hRluc /SV40],pGL4.73[hRluc /SV40] vector



pGL4.73[hRluc / SV40] Information

Alias: pGL4.73

Promoter: SV40

Replicon: pUC ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 3921bp

Prokaryotic resistance: ampicillin Amp

Clone strain: Escherichia coli DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: RVP3:CTAGCAAAATAGGCTGTCCC

Primers for 3'sequencing: primers designed based on sequences


pGL4.73[hRluc/SV40] Description

pGL4.73[hRluc/SV40]  encodes the luciferase reporter gene hRluc (Renilla reniformis) and is designed for high expression and reduced anomalous transcription. The pGL4 Vectors are engineered with fewer consensus regulatory sequences and a synthetic gene, which has been codon optimized for mammalian expression.The pGL4.73[hRluc/SV40] Vector contains the hRluc reporter gene and an SV40 early enhancer/promoter and can be used as an expression control or a co-reporter vector.


pGL4.73[hRluc/SV40] Cloning site



pGL4.73[hRluc/SV40] Sequence

LOCUS       Exported                3921 bp ds-DNA     circular SYN 26-JUL-2013
DEFINITION  SV40 promoter-containing internal control vector for strong 
            constitutive expression of Renilla luciferase.
KEYWORDS    pGL4.73[hRluc SV40]
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3921)
  AUTHORS   Promega
  TITLE     Direct Submission
  JOURNAL   Exported Sunday, September 4, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..3921
                     /organism="synthetic DNA construct"
                     /lab_host="Mammalian Cells"
                     /mol_type="other DNA"
     promoter        106..463
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      314..449
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             499..1434
                     /product="Renilla luciferase"
                     /note="human codon-optimized"
     polyA_signal    1475..1596
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(2015..2603)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(2803..3663)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     polyA_signal    3768..3816
                     /note="synthetic polyadenylation signal"
     misc_feature    3830..3921
                     /note="pause site"
                     /note="RNA polymerase II transcriptional pause signal from 
                     the human alpha-2 globin gene"
        1 ggcctaactg gccggtacct gagctcgcta gcctcgagga tatcagatct gcgcagcacc
       61 atggcctgaa ataacctctg aaagaggaac ttggttaggt accttctgag gcggaaagaa
      121 ccagctgtgg aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc cagcaggcag
      181 aagtatgcaa agcatgcatc tcaattagtc agcaaccagg tgtggaaagt ccccaggctc
      241 cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca tagtcccgcc
      301 cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc cgccccatgg
      361 ctgactaatt ttttttattt atgcagaggc cgaggccgcc tcggcctctg agctattcca
      421 gaagtagtga ggaggctttt ttggaggcct aggcttttgc aaaaagcttg gcaatccggt
      481 actgttggta aagccaccat ggcttccaag gtgtacgacc ccgagcaacg caaacgcatg
      541 atcactgggc ctcagtggtg ggctcgctgc aagcaaatga acgtgctgga ctccttcatc
      601 aactactatg attccgagaa gcacgccgag aacgccgtga tttttctgca tggtaacgct
      661 gcctccagct acctgtggag gcacgtcgtg cctcacatcg agcccgtggc tagatgcatc
      721 atccctgatc tgatcggaat gggtaagtcc ggcaagagcg ggaatggctc atatcgcctc
      781 ctggatcact acaagtacct caccgcttgg ttcgagctgc tgaaccttcc aaagaaaatc
      841 atctttgtgg gccacgactg gggggcttgt ctggcctttc actactccta cgagcaccaa
      901 gacaagatca aggccatcgt ccatgctgag agtgtcgtgg acgtgatcga gtcctgggac
      961 gagtggcctg acatcgagga ggatatcgcc ctgatcaaga gcgaagaggg cgagaaaatg
     1021 gtgcttgaga ataacttctt cgtcgagacc atgctcccaa gcaagatcat gcggaaactg
     1081 gagcctgagg agttcgctgc ctacctggag ccattcaagg agaagggcga ggttagacgg
     1141 cctaccctct cctggcctcg cgagatccct ctcgttaagg gaggcaagcc cgacgtcgtc
     1201 cagattgtcc gcaactacaa cgcctacctt cgggccagcg acgatctgcc taagatgttc
     1261 atcgagtccg accctgggtt cttttccaac gctattgtcg agggagctaa gaagttccct
     1321 aacaccgagt tcgtgaaggt gaagggcctc cacttcagcc aggaggacgc tccagatgaa
     1381 atgggtaagt acatcaagag cttcgtggag cgcgtgctga agaacgagca gtaattctag
     1441 agtcggggcg gccggccgct tcgagcagac atgataagat acattgatga gtttggacaa
     1501 accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga tgctattgct
     1561 ttatttgtaa ccattataag ctgcaataaa caagttaaca acaacaattg cattcatttt
     1621 atgtttcagg ttcaggggga ggtgtgggag gttttttaaa gcaagtaaaa cctctacaaa
     1681 tgtggtaaaa tcgataagga tccgtcgacc gatgcccttg agagccttca acccagtcag
     1741 ctccttccgg tgggcgcggg gcatgactat cgtcgccgca cttatgactg tcttctttat
     1801 catgcaactc gtaggacagg tgccggcagc gctcttccgc ttcctcgctc actgactcgc
     1861 tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt
     1921 tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg
     1981 ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg
     2041 agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat
     2101 accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta
     2161 ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct
     2221 gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc
     2281 ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa
     2341 gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg
     2401 taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaagaacag
     2461 tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
