pGL4.79[hRluc/ Neomycin] Plasmid


  • Model: PVT1315
  • 50 Units in Stock
Ask a question

Add to Cart:

pGL4.79[hRluc/ Neomycin]

Search name

pGL4.79[hRluc/Neomycin],Plasmid pGL4.79[hRluc/Neomycin],pGL4.79[hRluc/Neomycin] vector


pGL4.79[hRluc/ Neomycin] Information

Promoter: SV40

Replicon: pUC ori, SV40 ori

Terminator: SV40 poly (A) signal

Plasmid classification: mammalian cells, signal pathway reporting vectors

Plasmid size: 4879bp

Prokaryotic resistance: Amp

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: lactation cells

Induction mode: no need to induce, transient expression.

5'sequencing primers: RVP3:CTAGCAAAATAGGCTGTCCC

Primers for 3'sequencing: primers designed based on sequences



pGL4.79[hRluc/ Neomycin] Description

pGL4.79[hRluc/Neo] Vector encodes the luciferase reporter gene hRluc (Renilla reniformis) and is designed for high expression and reduced anomalous transcription. This vector also contains a mammalian selectable marker for neomycin resistance in which the number of transcription factor binding sites has been reduced and mammalian codon usage optimized. The pGL4 Vectors are engineered with fewer consensus regulatory sequences than the pGL3 Vectors and a synthetic reporter gene that has been codon optimized for mammalian expression. The pGL4.79[hRluc/Neo] Vector is a basic vector with no promoter. However, it contains a multiple cloning region that allows cloning of a promoter of choice.



pGL4.79[hRluc/ Neomycin] Sequence

LOCUS       Exported                4879 bp ds-DNA     circular SYN 26-JUL-2013
DEFINITION  Promoterless vector for measuring the activity of promoter and 
            enhancer sequences with a Renilla luciferase assay.
KEYWORDS    pGL4.79[hRluc Neo]
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4879)
  AUTHORS   Promega
  TITLE     Direct Submission
  JOURNAL   Exported Sunday, September 4, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..4879
                     /organism="synthetic DNA construct"
                     /lab_host="Mammalian Cells"
                     /mol_type="other DNA"
     misc_feature    1..70
                     /note="multiple cloning site"
     CDS             100..1035
                     /product="Renilla luciferase"
                     /note="human codon-optimized"
     polyA_signal    1076..1197
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     promoter        1391..1748
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      1599..1734
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             1779..2573
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     polyA_signal    2598..2646
                     /note="synthetic polyadenylation signal"
     rep_origin      complement(2973..3561)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(3761..4621)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     polyA_signal    4726..4774
                     /note="synthetic polyadenylation signal"
     misc_feature    4788..4879
                     /note="pause site"
                     /note="RNA polymerase II transcriptional pause signal from 
                     the human alpha-2 globin gene"
        1 ggcctaactg gccggtacct gagctcgcta gcctcgagga tatcaagatc tggcctcggc
       61 ggccaagctt ggcaatccgg tactgttggt aaagccacca tggcttccaa ggtgtacgac
      121 cccgagcaac gcaaacgcat gatcactggg cctcagtggt gggctcgctg caagcaaatg
      181 aacgtgctgg actccttcat caactactat gattccgaga agcacgccga gaacgccgtg
      241 atttttctgc atggtaacgc tgcctccagc tacctgtgga ggcacgtcgt gcctcacatc
      301 gagcccgtgg ctagatgcat catccctgat ctgatcggaa tgggtaagtc cggcaagagc
      361 gggaatggct catatcgcct cctggatcac tacaagtacc tcaccgcttg gttcgagctg
      421 ctgaaccttc caaagaaaat catctttgtg ggccacgact ggggggcttg tctggccttt
      481 cactactcct acgagcacca agacaagatc aaggccatcg tccatgctga gagtgtcgtg
      541 gacgtgatcg agtcctggga cgagtggcct gacatcgagg aggatatcgc cctgatcaag
      601 agcgaagagg gcgagaaaat ggtgcttgag aataacttct tcgtcgagac catgctccca
      661 agcaagatca tgcggaaact ggagcctgag gagttcgctg cctacctgga gccattcaag
      721 gagaagggcg aggttagacg gcctaccctc tcctggcctc gcgagatccc tctcgttaag
      781 ggaggcaagc ccgacgtcgt ccagattgtc cgcaactaca acgcctacct tcgggccagc
      841 gacgatctgc ctaagatgtt catcgagtcc gaccctgggt tcttttccaa cgctattgtc
      901 gagggagcta agaagttccc taacaccgag ttcgtgaagg tgaagggcct ccacttcagc
      961 caggaggacg ctccagatga aatgggtaag tacatcaaga gcttcgtgga gcgcgtgctg
     1021 aagaacgagc agtaattcta gagtcggggc ggccggccgc ttcgagcaga catgataaga
     1081 tacattgatg agtttggaca aaccacaact agaatgcagt gaaaaaaatg ctttatttgt
     1141 gaaatttgtg atgctattgc tttatttgta accattataa gctgcaataa acaagttaac
     1201 aacaacaatt gcattcattt tatgtttcag gttcaggggg aggtgtggga ggttttttaa
     1261 agcaagtaaa acctctacaa atgtggtaaa atcgataagg atccgtttgc gtattgggcg
     1321 ctcttccgct gatctgcgca gcaccatggc ctgaaataac ctctgaaaga ggaacttggt
     1381 tagctacctt ctgaggcgga aagaaccagc tgtggaatgt gtgtcagtta gggtgtggaa
     1441 agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
