pGreen II- 0800- Luc


  • Model: PVT11187
  • 47 Units in Stock
Ask a question

Add to Cart:

pGreen II-0800-Luc

Catalog No. PVT11187
Packing 2ug


pGreenII 0800-Luc Information

Promoter: CaMV 35S, T7

Replicon: pSa ori, ori

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 6382bp

Prokaryotic resistance: Kan

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

Primers for 3'sequencing: primers designed based on sequences


pGreenII 0800-Luc Description

We describe novel plasmid vectors for transient gene expression usingAgrobacterium, infiltrated into Nicotiana benthamiana leaves. We have generated a series of pGreenIIcloning vectors that are ideally suited to transient gene expression, by removing elements of onventional binary vectors necessary for stable transformation such as transformation selection genes.


pGreenII 0800-Luc Multiple cloning site




pGreenII 0800-Luc Sequence

LOCUS       Exported                6382 bp ds-DNA     circular SYN 14-SEP-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 8

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 6382)


  TITLE     Direct Submission

  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1

FEATURES             Location/Qualifiers

     source          1..6382

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     misc_feature    542..564

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA 


     promoter        626..971

                     /note="CaMV 35S promoter"

                     /note="strong constitutive promoter from cauliflower mosaic


     CDS             982..1917


                     /product="luciferase from the anthozoan coelenterate 

                     Renilla reniformis (sea pansy)"








     polyA_signal    1974..2150

                     /note="CaMV poly(A) signal"

                     /note="cauliflower mosaic virus polyadenylation signal"

     primer_bind     2314..2330

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     promoter        2337..2355

                     /note="T7 promoter"

                     /note="promoter for bacteriophage T7 RNA polymerase"

     primer_bind     2381..2397

                     /note="KS primer"

                     /note="common sequencing primer, one of multiple similar 


     primer_bind     complement(2431..2447)

                     /note="SK primer"

                     /note="common sequencing primer, one of multiple similar 


     CDS             2479..4131



                     /product="firefly luciferase"


                     /note="enhanced luc+ version of the luciferase gene"











     polyA_signal    4188..4364

                     /note="CaMV poly(A) signal"

                     /note="cauliflower mosaic virus polyadenylation signal"

     misc_feature    4374..4398

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"

     rep_origin      complement(4489..5077)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(5248..6063)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin in bacteria or G418 

                     (Geneticin(R)) in eukaryotes"






     rep_origin      6354..407

                     /note="pSa ori"

                     /note="origin of replication from bacterial plasmid pSa"


        1 tttttatccc cggaagcctg tggatagagg gtagttatcc acgtgaaacc gctaatgccc

       61 cgcaaagcct tgattcacgg ggctttccgg cccgctccaa aaactatcca cgtgaaatcg

      121 ctaatcaggg tacgtgaaat cgctaatcgg agtacgtgaa atcgctaata aggtcacgtg

      181 aaatcgctaa tcaaaaaggc acgtgagaac gctaatagcc ctttcagatc aacagcttgc

      241 aaacacccct cgctccggca agtagttaca gcaagtagta tgttcaatta gcttttcaat

      301 tatgaatata tatatcaatt attggtcgcc cttggcttgt ggacaatgcg ctacgcgcac

      361 cggctccgcc cgtggacaac cgcaagcggt tgcccaccgt cgagcgccag cgcctttgcc

      421 cacaacccgg cggccggccg caacagatcg ttttataaat tttttttttt gaaaaagaaa

      481 aagcccgaaa ggcggcaacc tctcgggctt ctggatttcc gatccccgga attagagatc

      541 ttggcaggat atattgtggt gtaacgttat cgtaccccta ctccaaaaat gtcaaagata

      601 cagtctcaga agaccaaagg gctattgaga cttttcaaca aagggtaatt tcgggaaacc

      661 tcctcggatt ccattgccca gctatctgtc acttcatcga aaggacagta gaaaaggaag

      721 gtggctccta caaatgccat cattgcgata aaggaaaggc tatcattcaa gatgcctctg

      781 ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg

      841 ttccaaccac gtcttcaaag caagtggatt gatgtgacat ctccactgac gtaagggatg

      901 acgcacaatc ccactatcct tcgcaagacc cttcctctat ataaggaagt tcatttcatt

      961 tggagaggac agcccaccac catgacttcg aaagtttatg atccagaaca aaggaaacgg

     1021 atgataactg gtccgcagtg gtgggccaga tgtaaacaaa tgaatgttct tgattcattt

     1081 attaattatt atgattcaga aaaacatgca gaaaatgctg ttattttttt acatggtaac

     1141 gcggcctctt cttatttatg gcgacatgtt gtgccacata ttgagccagt agcgcggtgt

     1201 attataccag accttattgg tatgggcaaa tcaggcaaat ctggtaatgg ttcttatagg

     1261 ttacttgatc attacaaata tcttactgca tggtttgaac ttcttaattt accaaagaag

     1321 atcatttttg tcggccatga ttggggtgct tgtttggcat ttcattatag ctatgagcat

     1381 caagataaga tcaaagcaat agttcacgct gaaagtgtag tagatgtgat tgaatcatgg

     1441 gatgaatggc ctgatattga agaagatatt gcgttgatca aatctgaaga aggagaaaaa

     1501 atggttttgg agaataactt cttcgtggaa accatgttgc catcaaaaat catgagaaag

     1561 ttagaaccag aagaatttgc agcatatctt gaaccattca aagagaaagg tgaagttcgt

     1621 cgtccaacat tatcatggcc tcgtgaaatc ccgttagtaa aaggtggtaa acctgacgtt

     1681 gtacaaattg ttaggaatta taatgcttat ctacgtgcaa gtgatgattt accaaaaatg

     1741 tttattgaat cggacccagg attcttttcc aatgctattg ttgaaggtgc caagaagttt

     1801 cctaatactg aatttgtcaa agtaaaaggt cttcattttt cgcaagaaga tgcacctgat

     1861 gaaatgggaa aatatatcaa atcgttcgtt gagcgagttc tcaaaaatga acaataattc

     1921 tagccggtac gctgaaatca ccagtctctc tctacaaatc tatctctctc tattttctcc

     1981 ataaataatg tgtgagtagt ttcccgataa gggaaattag ggttcttata gggtttcgct

     2041 catgtgttga gcatataaga aacccttagt atgtatttgt atttgtaaaa tacttctatc

     2101 aataaaattt ctaattccta aaaccaaaat ccagtactaa aatccagatc gataacatta

     2161 acgtttacaa tttccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc

     2221 gggcctcttc gctattacgc cagctggcga aagggggatg tgctgcaagg cgattaagtt

     2281 gggtaacgcc agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat

     2341 acgactcact atagggcgaa ttgggtaccg ggccccccct cgaggtcgac ggtatcgata

     2401 agcttgatat cgaattcctg cagcccgggg gatccactag ttctagagcg gccgccaccg

     2461 cggtggagat cgaattccat ggaagacgcc aaaaacataa agaaaggccc ggcgccattc

     2521 tatccgctgg aagatggaac cgctggagag caactgcata aggctatgaa gagatacgcc

     2581 ctggttcctg gaacaattgc ttttacagat gcacatatcg aggtggacat cacttacgct

     2641 gagtacttcg aaatgtccgt tcggttggca gaagctatga aacgatatgg gctgaataca

     2701 aatcacagaa tcgtcgtatg cagtgaaaac tctcttcaat tctttatgcc ggtgttgggc

     2761 gcgttattta tcggagttgc agttgcgccc gcgaacgaca tttataatga acgtgaattg

     2821 ctcaacagta tgggcatttc gcagcctacc gtggtgttcg tttccaaaaa ggggttgcaa

     2881 aaaattttga acgtgcaaaa aaagctccca atcatccaaa aaattattat catggattct

     2941 aaaacggatt accagggatt tcagtcgatg tacacgttcg tcacatctca tctacctccc

     3001 ggttttaatg aatacgattt tgtgccagag tccttcgata gggacaagac aattgcactg

     3061 atcatgaact cctctggatc tactggtctg cctaaaggtg tcgctctgcc tcatagaact

     3121 gcctgcgtga gattctcgca tgccagagat cctatttttg gcaatcaaat cattccggat

     3181 actgcgattt taagtgttgt tccattccat cacggttttg gaatgtttac tacactcgga

     3241 tatttgatat gtggatttcg agtcgtctta atgtatagat ttgaagaaga gctgtttctg

     3301 aggagccttc aggattacaa gattcaaagt gcgctgctgg tgccaaccct attctccttc

     3361 ttcgccaaaa gcactctgat tgacaaatac gatttatcta atttacacga aattgcttct

     3421 ggtggcgctc ccctctctaa ggaagtcggg gaagcggttg ccaagaggtt ccatctgcca

     3481 ggtatcaggc aaggatatgg gctcactgag actacatcag ctattctgat tacacccgag

     3541 ggggatgata aaccgggcgc ggtcggtaaa gttgttccat tttttgaagc gaaggttgtg

     3601 gatctggata ccgggaaaac gctgggcgtt aatcaaagag gcgaactgtg tgtgagaggt

     3661 cctatgatta tgtccggtta tgtaaacaat ccggaagcga ccaacgcctt gattgacaag

     3721 gatggatggc tacattctgg agacatagct tactgggacg aagacgaaca cttcttcatc

     3781 gttgaccgcc tgaagtctct gattaagtac aaaggctatc aggtggctcc cgctgaattg

     3841 gaatccatct tgctccaaca ccccaacatc ttcgacgcag gtgtcgcagg tcttcccgac

     3901 gatgacgccg gtgaacttcc cgccgccgtt gttgttttgg agcacggaaa gacgatgacg

     3961 gaaaaagaga tcgtggatta cgtcgccagt caagtaacaa ccgcgaaaaa gttgcgcgga

     4021 ggagttgtgt ttgtggacga agtaccgaaa ggtcttaccg gaaaactcga cgcaagaaaa

     4081 atcagagaga tcctcataaa ggccaagaag ggcggaaaga tcgccgtgta attctagaga

     4141 attcgctgaa atcaccagtc tctctctaca aatctatctc tctctatttt ctccataaat

     4201 aatgtgtgag tagtttcccg ataagggaaa ttagggttct tatagggttt cgctcatgtg

     4261 ttgagcatat aagaaaccct tagtatgtat ttgtatttgt aaaatacttc tatcaataaa

     4321 atttctaatt cctaaaacca aaatccagta ctaaaatcca gatccactag ccttgacagg

     4381 atatattggc gggtaaacta agtcgctgta tgtgtttgtt tgagatctca tgtgagcaaa

     4441 aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct

     4501 ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac

     4561 aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc

     4621 gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc

     4681 tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg

     4741 tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga

     4801 gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag

     4861 cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta

     4921 cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaagaag

     4981 agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg

     5041 caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac

     5101 ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc

     5161 aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag

     5221 tatatatgtg taacattggt ctagtgatta gaaaaactca tcgagcatca aatgaaactg

     5281 caatttattc atatcaggat tatcaatacc atatttttga aaaagccgtt tctgtaatga

     5341 aggagaaaac tcaccgaggc agttccatag gatggcaaga tcctggtatc ggtctgcgat

     5401 tccgactcgt ccaacatcaa tacaacctat taatttcccc tcgtcaaaaa taaggttatc

     5461 aagtgagaaa tcaccatgag tgacgactga atccggtgag aatggcaaaa gtttatgcat

     5521 ttctttccag acttgttcaa caggccagcc attacgctcg tcatcaaaat cactcgcatc

     5581 aaccaaaccg ttattcattc gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt

     5641 aaaaggacaa ttacaaacag gaatcgaatg caaccggcgc aggaacactg ccagcgcatc

     5701 aacaatattt tcacctgaat caggatattc ttctaatacc tggaatgctg ttttccctgg

     5761 gatcgcagtg gtgagtaacc atgcatcatc aggagtacgg ataaaatgct tgatggtcgg

     5821 aagaggcata aattccgtca gccagtttag tctgaccatc tcatctgtaa caacattggc

     5881 aacgctacct ttgccatgtt tcagaaacaa ctctggcgca tcgggcttcc catacaatcg

     5941 gtagattgtc gcacctgatt gcccgacatt atcgcgagcc catttatacc catataaatc

     6001 agcatccatg ttggaattta atcgcggcct tgagcaagac gtttcccgtt gaatatggct

     6061 cataacaccc cttgtattac tgtttatgta agcagacagt tttattgttc atgatgatat

     6121 atttttatct tgtgcaatgt aacatcagag attttgagac acaacgtggc tttgttgaat

     6181 aaatcgaact tttgctgagt tgaaggatca gatcacgcat cttcccgaca acgcagaccg

     6241 ttccgtggca aagcaaaagt tcaaaatcac caactggtcc acctacaaca aagctctcat

     6301 caaccgtggc tccctcactt tctggctgga tgatggggcg attcaggcga tccccatcca

     6361 acagcccgcc gtcgagcggg ct



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
