pGreen-puro

Search name

pGreen-puro,Plasmid pGreen-puro,pGreen-puro vector

 

pGreen-puro Informaiton

Promoter: CMV

Replicon: pUC ori

Terminator: SV40 poly (A) signal

Plasmid classification: virus series, lentivirus cloning vector

Plasmid size: 7.8kb

Prokaryotic resistance: Amp

Screening markers: Puro

Cloned strain: Stbl3

Culture conditions: 37 centigrade, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, instantaneous expression

5'sequencing primers: CMV-F:CGCAAATGGGCGGTAGGCGTG

3'sequencing primers: primers designed according to sequence

Use:Lentiviral

 

pGreen-puro Description

pGreenPuro Vector  is designed to express a single-stranded shRNA sequence with a fold-back stem-loop structure (also known as a “hairpin”) from a RNA polymerase III H1 promoter .The hairpin-type siRNA (shRNA) template oligonucleotides need to be cloned into unique BamHI/EcoRI sites located just downstream of an H1 promoter. The pGreenPuro™ vector needs to be linearized by restriction digest with BamHI and EcoRI, and purified to remove the stuffer fragment. When linearized, the vector contains two unique 5’ overhangs to facilitate directional cloning of shRNA template oligos with minimal self-ligation background . When the shRNA construct is expressed from constitutive H1 promoter and terminated with the TTTTT sequence, the shRNA transcript folds into the hairpin structure, which is recognized by the DICER enzyme, cleaved to form a functional ds siRNA and transferred to a RISC complex for selective digestion of complementary target mRNAs .